Labshake search
Citations for Agilent :
1451 - 1493 of 1493 citations for 4 Chloro 2 methoxy N 2 4 methoxy phenyl ethyl benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Plant Biology 2024Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP-GR variants for RNA-seq and N&B were generated with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) or by Gene Universal.
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality of the N=41 total RNA preparations was assessed on an Agilent TapeStation 4200 (Agilent, Santa Clara, CA, USA) and N=40 samples remained based on an RNA integrity number cut-off of > 5.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... The NDec1-98 mutant was prepared using purified N-His6 Dec plasmid DNA from a DH5α bacterial culture that was obtained using a StrataPrep plasmid miniprep kit (Agilent Technologies). Replacing codon 99 with a stop codon was accomplished by site-directed mutagenesis ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... variants of CaMKII with N-terminal His6-SUMO tag were co-expressed with λ phosphatase in Escherichia coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) in LB medium at 16 □ for 24 h ...
-
bioRxiv - Genetics 2024Quote: ... the UV and LC-MS/MS raw data is batch processed (n=96, by plate) using Masshunter Qualitative Analysis (Agilent, Version 8.0) and Masshunter Quantitative Analysis (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... A P/O ratio of 2.75 has been validated for calculating the OXPHOS ATP production rate in cells (Romero N et al Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology). Thus ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Immunology 2023Quote: ... was amplified using primers listed in Table S2 and cloned into SrfI and EcoRI-linearized pCMVtag2B vector (N-terminal FLAG epitope-containing plasmid from Agilent Technologies, Cat# 211172) using Gibson Assembly (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Hepta-N-acetyl Chitoheptaose (Cat. no.# 57/11-0010) were analyzed with TSK-Gel (Cat. no.# G2000SWx.) on HPLC (Agilent Technologies 1260 Infinity). The change in refractive index was observed over time for different samples ...
-
bioRxiv - Physiology 2022Quote: ... RNAs were extracted from n = 9 to 15 independent livers per group and RNA quality assessed using a TapeStation 4200 instrument (Agilent, Santa Clara, CA, USA). High quality RNA samples (RIN > 9.0 ...
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity, Agilent, Santa Clara, CA, USA). Fully expanded mature leaves were punched from the middle position to collect leaf discs using a size 10 (2.54 cm2 leaf area ...
-
bioRxiv - Cancer Biology 2023Quote: ... that were freshly obtained prior to start of pembrolizumab (n=32) using the companion diagnostic assay of pembrolizumab (PD-L1 IHC 22C3 pharmDx, Agilent Technologies, Carpinteria, CA, USA). When no fresh tumor biopsy was available ...
-
bioRxiv - Plant Biology 2024Quote: ... and the size of the library fractions were estimated from a smear analysis performed on the FEMTO Pulse® System (Agilent, P/N M5330AA).
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Bioengineering 2020Quote: ... The concentration of the ester in the n-hexadecane phase was quantified using a gas chromatography-mass spectrometry (GC-MS, Agilent Technologies 6890N, Santa Clara, CA) equipped with an HP-5 column (60m×0.25 mm ...
-
bioRxiv - Physiology 2023Quote: ... Samples and standards were analysed in triplicate using an Agilent 5973 N mass selective detector coupled to an Agilent 6890 gas chromatography system (Agilent Technologies, Santa Clara, CA, USA). A CD624-GC column (30 m 30.25 mm 31.40 mm ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples and standards were analysed in triplicate by using an Agilent 5973 N mass selective detector coupled to an Agilent 6890 gas chromatography system (Agilent Technologies, Santa Clara, CA, USA). A CD624-GC column (30 m ...
-
bioRxiv - Molecular Biology 2023Quote: ... Desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies, Santa Clara, CA, USA) coupled to PEGASUS 4D mass spectrometer (LECO Corporation) ...