Labshake search
Citations for Agilent :
1451 - 1500 of 3255 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: Double immunohistochemistry was performed on 2-μm thick deparaffinized sections by using primary antibodies against Foxp3 (rabbit monoclonal, clone SP97 [Zytomed], 1:50 dilution, 30 min incubation) and α-SMA (mouse monoclonal, clone 1A4 [Dako], 1:200 dilution, 30 min incubation), respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... for 60 minutes and developed with DAB chromogen (1:50, DAKO #K3468). Sections were counterstained with hematoxylin (DiaPath #C0305) ...
-
bioRxiv - Microbiology 2020Quote: ... incubated for 1 hr with polyclonal rabbit-anti-mouse Ig antibody (Dako) in PBS-T + 0.1% BSA ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µl PfuTurbo Cx hotstart polymerase (2.5 U/µl, Agilent Technologies, CA), 5 µl 10X PfuTurbo Cx reaction buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... (12) mouse anti-PCNA was used at 1:1000 (M0879; Dako Immunochemicals). This antibody was raised to a synthetic amino acid sequence (LVFEAPNQEK ...
-
bioRxiv - Neuroscience 2021Quote: ... + rabbit anti-GFAP (1:500 dilutio L gilent Dako cat. no. Z0334), or mouse anti-GFAP (1:500 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... and secondary antibody Rabbit anti-goat Ig HRP (1:5,000, #P0160, Dako).
-
bioRxiv - Pathology 2020Quote: Deparaffinized sections were boiled in 1× target retrieval solution (Dako, Capenteria, CA) for 20 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was prepared using miRNA 1-st strand cDNA synthesis kit (Agilent). Mature miRNA sequence and Universal reverse primer (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... Coverslips were treated with RNace-iT cocktail (1:1000 dilution, Agilent Technologies) at 37°C for 1 hour and dehydrated in a 70% ...
-
bioRxiv - Neuroscience 2020Quote: ... polyclonal rabbit anti-GFAP (1:500; Z0334, Dako, Agilent, Santa Clara, CA), polyclonal goat anti-DCX (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... polyclonal rabbit anti-GFAP (1:500; Z0334, Dako, Agilent, Santa Clara, CA), polyclonal goat anti-DCX (1:250 ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were treated with 1 mg/ml pepsin (catalog #S3002; Dako) in 1 M HCl with 0.1 M PB at 37°C for 6 min and then washed in 0.1 M PB ...
-
bioRxiv - Microbiology 2021Quote: ... For replicates 1 and 2 a Strategene Mx3005P PCR machine (Agilent, USA) was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Horseradish peroxidase-conjugated RAMPx and SWARPx Abs (both DakoCytomation, dilution 1:1000) were used as secondary Abs ...
-
bioRxiv - Microbiology 2020Quote: ... and the respective secondary antibody goat anti-mouse-HRP (1:3000, DAKO) were used ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-glial fibrillary acidic protein (GFAP, 1:2000; Z033429, Dako, Denmark) or anti-Ionized calcium-binding adaptor molecule-1(Iba-1 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Cancer Biology 2020Quote: ... in XF RPMI Medium pH 7.4 with 1 mM HEPES (Agilent Technologies), supplemented with 2.75 mM glucose ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C.
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-SMA (1:1000; M0851; Clone14A; Dako, Denmark AS, Denmark) was labeled with Alexa Fluor 647 tyramide solution ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies CD31 (1:200, M082329-2, DAKO), NG2 (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by O/N incubation of primary antibody (GFAP (1:500, Dako) in 2% BSA ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-conjugated goat polyclonal anti-rabbit immunoglobulin (1:500 dilution, P0448 Dako) was used as secondary antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM TCEP) attached to a 1260 Infinity II LC System (Agilent). MALS was carried out using a Wyatt DAWN detector attached in line with the size exclusion column ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-rabbit IgG conjugated to HRP (1:2000, Cat#P0217, Dako) were used as primary and secondary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... in XF RPMI Medium pH 7.4 with 1 mM HEPES (Agilent Technologies) supplemented with 2.75 mM glucose ...
-
bioRxiv - Microbiology 2020Quote: ... A biotinylated goat anti-rabbit IgG antibody (1/500; DakoCytomation, Glostrup, Denmark) served as secondary antibody ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were detected using biotinylated IgG secondary antibodies (Agilent, 1:400), using streptavidin-HRP (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B lymphocytes (anti-CD20 mouse IgG2a, 1:150, clone L26, Dako). Tumor epithelial cells were detected using anti-pan-cytokeratin Alexa 488-conjugated mouse IgG1 (1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Dako, 1:10,000) and washed ...
-
bioRxiv - Cancer Biology 2021Quote: ... The anti-CD8 antibody (1:5,000, C8/144B, mouse monoclonal antibody, Agilent) was detected using the Opal 520 fluorophore (1:150 ...
-
bioRxiv - Neuroscience 2022Quote: ... DR (‘anti-MHC II’, mouse IgG1, Dako clone CR3/43, 1:150), anti-Calbindin (mouse IgG1 ...
-
bioRxiv - Immunology 2022Quote: ... GFAP was detected with polyclonal rabbit-anti human GFAP (1:500, Agilent) and donkey anti-rabbit IgG AF55 detection (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1:5000 swine anti-rabbit immunoglobulin HRP conjucated (RRID:AB_2617141, P0399, Agilent).
-
bioRxiv - Pathology 2020Quote: ... sections were incubated with secondary antibodies coupled with HRP (1:200) (DAKO, Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... was diluted 1:500 with EnVision FLEX Antibody Diluent (K800621, Dako, Agilent) and incubated for 120 min ...
-
bioRxiv - Cell Biology 2020Quote: ... was diluted 1:500 with EnVision FLEX Antibody Diluent (K800621, Dako, Agilent) and incubated for 120 min ...
-
bioRxiv - Immunology 2020Quote: ... or rabbit anti-human IgA/HRP (Dako: cat. P0216, 1:5’000 dilution). Assays were developed by addition of 3,3’,5,5’-Tetramethylbenzidine (TMB ...
-
bioRxiv - Microbiology 2020Quote: ... or fluorescein isothiocynate (FITC)-conjugated goat anti-mouse IgG (Dako; 1:200), respectively ...
-
bioRxiv - Genetics 2020Quote: ... following antibodies and related dilutions were used: MyoD (Dako, M3512, 1:800), Pax7 (Developmental Studies Hybridoma Bank ...