Labshake search
Citations for Agilent :
101 - 150 of 1828 citations for Sumo2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti GFAP (Dako, product no ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-Plyz (Dako), rat anti-RFP (Chromotek) ...
-
bioRxiv - Pathology 2020Quote: ... rabbit α-GFAP (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... or EnVision rabbit (Dako) with NOVAred substrate (Vector) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or anti-rabbit (Dako) HRP-conjugated secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-GFAP (rabbit, Dako, catalog #z0334 ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD3 (Rabbit polyclonal, Dako) at 1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Rabbit/Mouse (Dako, Denmark).
-
bioRxiv - Pathology 2023Quote: ... rabbit anti-FITC (Dako) and Brightvision goat anti-rabbit HRP (Immunologic ...
-
bioRxiv - Neuroscience 2023Quote: ... or rabbit (DAKO; P0448) HRP at 1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... CD117 (rabbit polyclonal, Dako), or glycophorin A (rabbit monoclonal ...
-
bioRxiv - Pathology 2023Quote: ... rabbit immunoglobulin (Dako/Agilent), or anti-sheep secondary antibodies (Jackson ImmunoResearch Inc ...
-
bioRxiv - Pathology 2023Quote: ... rabbit immunoglobulin (Dako/Agilent), or anti-sheep secondary antibodies (Jackson ImmunoResearch Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100β (DakoCytomation) at 1:750 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Rabbit Envision (Agilent, K4003). The sections were rinsed with wash buffer and visualised using DAB with the Intense R kit.
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated with horseradish peroxidase-conjugated rabbit anti-goat or swine anti-rabbit or rabbit anti-mouse antibodies (Dako, Agilent Technologies) and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... or polyclonal rabbit anti-rabbit immunoglobulins/HRP (Dako: Code no. P0448, 1:2000) at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were washed with phosphate-buffered saline (PBS) then incubated with horseradish peroxidase-conjugated rabbit anti-goat or swine anti-rabbit or rabbit anti-mouse antibodies (Dako, Agilent Technologies) and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... The pST39-BLOC-1 plasmid encoding recombinant BLOC-1 was transformed into BL21gold(DE3)plysS cells (230134, Agilent). Several colonies from the plate were inoculated into a starter culture of 10 ml LB supplemented with 34 μg/ml chloramphenicol and 100 μg/ml ampicillin that was grown overnight at 37 °C with moderate shaking ...
-
bioRxiv - Cell Biology 2021Quote: All recombinant proteins were expressed in either BL21-CodonPlus (DE3)-RIPL or ArcticExpress (DE3) competent cells (Agilent Technologies) grown in LB medium overnight at 13-16°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins (GST, GST-BZR1, GST-PIF3 and GST-H2A) expressed in BL21- CodonPlus (DE3)-RIL (Agilent Technologies) were purified using glutathione beads ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Biochemistry 2022Quote: ... goat anti-rabbit and rabbit anti-goat secondary antibodies conjugated to HRP (Dako-Agilent) were used at a dilution of 1:7000 ...
-
bioRxiv - Biochemistry 2022Quote: ... goat anti-rabbit and rabbit anti-goat secondary antibodies conjugated to HRP (Dako-Agilent) were used at a dilution of 1:7000 ...
-
bioRxiv - Neuroscience 2021Quote: ... polyclonal rabbit anti-mouse IgG biotinylated and polyclonal goat anti-rabbit IgG biotinylated (Dako) (IHC ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies HRP-conjugated rabbit anti-mouse and swine anti-rabbit (Dako Cytomation, DK) were used at a 1:10’000 dilution.
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies (rabbit anti-AQP4, 1:500, MerckMillipore; rabbit anti-GFAP, 1:500, Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Goat Anti-Rabbit and Rabbit Anti-Mouse horseradish peroxidase-(HRP) conjugated secondary antibodies (Dako) were used in our experiments.
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... Rabbit-Mouse kit (Dako, Denmark). Sections were counterstained with haematoxylin (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: Rabbit anti-GFAP (Z0334, Dako) 1:200
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-HBcAg (B0586, DAKO), mouse anti-HA-tag (sc-7392 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-GFAP (Agilent; RRID:AB_10013482), Alexa Fluor 647 isolectin GS-IB4 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or anti-rabbit (Dako, P0448)) ...
-
bioRxiv - Systems Biology 2019Quote: ... and rabbit anti-lysozyme (Dako), followed by Alexa Fluor-488 and −594 conjugated secondary antibodies (ThermoFisher Scientific) ...