Labshake search
Citations for Agilent :
101 - 150 of 469 citations for N N Dimethyl 4 4 Trimethylsilyl Ethynyl Phenyl Ethynyl Aniline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Tpm isoforms Tpm1.6 and Tpm3.1 (with and without Met-Ala-Ser at the N-terminus) were expressed in ArcticExpress(DE3) RIL cells (Agilent Technologies), grown in Terrific Broth (TB ...
-
bioRxiv - Biochemistry 2020Quote: ... Salmonella typhimurium MsbA (T561C in a C88A/C315A cysteine-less background) with an N-terminal poly-histidine-tag was expressed in BL21-CodonPlus (DE3)-RIPL (Agilent). Expression was induced with 1 mM IPTG for 4 hours at 30°C and membrane proteins were solubilized with 1% DDM and 0.04% sodium cholate in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μl of culture headspace was sampled via gas-tight syringe and subject to gas chromatography through a HayeSep N column (Agilent) at 90°C in N2 carrier gas ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Biochemistry 2022Quote: ... or a FLAG tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was added on the N-terminus of MBP WT or R919* TRPA1 using Quikchange Lightning site-directed mutagenesis (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Plant Biology 2024Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP-GR variants for RNA-seq and N&B were generated with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) or by Gene Universal.
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μM of Carbonyl-cyanide-4 (triflouoromethoxy) phenylhydrazone (FCCP) (Agilent) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality of the N=41 total RNA preparations was assessed on an Agilent TapeStation 4200 (Agilent, Santa Clara, CA, USA) and N=40 samples remained based on an RNA integrity number cut-off of > 5.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... The NDec1-98 mutant was prepared using purified N-His6 Dec plasmid DNA from a DH5α bacterial culture that was obtained using a StrataPrep plasmid miniprep kit (Agilent Technologies). Replacing codon 99 with a stop codon was accomplished by site-directed mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... variants of CaMKII with N-terminal His6-SUMO tag were co-expressed with λ phosphatase in Escherichia coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) in LB medium at 16 □ for 24 h ...
-
bioRxiv - Genetics 2024Quote: ... the UV and LC-MS/MS raw data is batch processed (n=96, by plate) using Masshunter Qualitative Analysis (Agilent, Version 8.0) and Masshunter Quantitative Analysis (Agilent ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.5 mg DW of previously treated samples was taken for monosaccharide analysis by Trimethylsilyl derivatization (TMS) and were analysed as described previously55 with GC/MS (7890A/5975C; Agilent Technologies). To determine the degree of methyl esterification ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...