Labshake search
Citations for Agilent :
101 - 150 of 6754 citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The plate was thoroughly washed 5 times with PBS-T and 100 μL of TMB-Blue substrate (DAKO) was added followed by incubation in the dark for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Neuroscience 2021Quote: ... and sections embedded in fluorescent mounting medium (Dako, S3023). For quantification of pFTAA positive Aβ plaques ...
-
bioRxiv - Neuroscience 2021Quote: ... and coverslips embedded in fluorescent mounting medium (Dako, S3023). Images were acquired using Leica TCS SP5 confocal laser scanning microscope controlled by LAS AF scan software (Leica Microsystems ...
-
bioRxiv - Neuroscience 2020Quote: ... coverslipped using Dako fluorescent mounting medium (DAKO NA; #S3023), and imaged ...
-
bioRxiv - Neuroscience 2021Quote: ... and mounted in Dako fluorescent mounting medium (Dako, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Tissues were mounted with Dako Fluorescent Mounting Medium (Agilent) and imaged using Axio Imager M2 microscope (Zeiss ...
-
bioRxiv - Microbiology 2020Quote: ... coverslips were embedded in Fluorescent Mounting medium (Dako; S30230) on microscopic glass slides and dried overnight in the dark at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were mounted using Fluorescent Mounting Medium (Dako #S3023), sealed with nail polish and kept at 4°C in the dark ...
-
bioRxiv - Developmental Biology 2020Quote: ... Coverslips were placed in Fluorescent Mounting Medium (DAKO Cytomation) on a glass microscope slide and dried overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Slides were mounted in fluorescent mounting medium from Dako. Primary antibodies used were against Dystrophin (Leica) ...
-
bioRxiv - Neuroscience 2022Quote: ... and mounted in DAKO fluorescent mounting medium (Agilent Technologies). Images were acquired using a confocal microscope (Zeiss LSM800 ...
-
bioRxiv - Pathology 2022Quote: ... Slides were mounted using fluorescent mounting medium (Dako, S3023). Photomicrographs were taken with a Zeiss Axiophot photomicroscope and Axiovision software ...
-
bioRxiv - Cancer Biology 2019Quote: ... Slides were mounted with fluorescent mounting medium (Dako Agilent) and analyzed with wide field Axioskop2 mot plus microscope (Zeiss ...
-
bioRxiv - Cancer Biology 2019Quote: ... Slides were mounted with fluorescent mounting medium (Dako Agilent) and analyzed with wide field Axioskop2 mot plus microscope (Zeiss ...
-
bioRxiv - Microbiology 2021Quote: ... Slides were mounted using DAKO fluorescent mounting medium (Dako).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... sections were mounted with fluorescent mounting medium (S3023, Dako) and dried ...
-
bioRxiv - Physiology 2020Quote: ... The slides were mounted with fluorescent mounting media (Dako). Negative control stainings were performed by omitting the primary antibodies from the protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... and coverslips were mounted with fluorescent mounting medium (Dako). Confocal images were acquired on an LSM 510 Meta confocal microscope (Zeiss ...
-
bioRxiv - Neuroscience 2020Quote: ... and coverslips embedded in fluorescent mounting medium (Dako, S3023). Images were acquired using Leica TCS SP5 confocal laser scanning microscope controlled by LAS AF scan software (Leica Microsystems ...
-
bioRxiv - Neuroscience 2020Quote: ... and sections embedded in fluorescent mounting medium (Dako, S3023). For quantification of pFTAA positive Aβ plaques ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Immunostained cryosections were mounted with fluorescent mounting medium (DAKO) and covered with coverslips ...
-
bioRxiv - Neuroscience 2022Quote: ... mounted and coverslipped using fluorescent mounting medium (DAKO, S3023) containing diluted 4,6-diamidino-2-phenylindole DAPI (dilution 1:50000) ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted using Fluorescent Mounting Medium (#S3023, Dako).
-
bioRxiv - Bioengineering 2022Quote: ... sections were mounted with a fluorescent mounting medium (Dako).
-
bioRxiv - Molecular Biology 2023Quote: ... samples were mounted with fluorescent mounting medium (Dako, S3023). Fluorescence images were taken using a Zeiss LSM 900 confocal microscope with a 63X lens.
-
bioRxiv - Immunology 2023Quote: ... Slides were mounted with a fluorescent mounting medium (Dako) after DAPI (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... and mounted with DAKO Fluorescent Mounting medium (Dako Canada) onto microscope slides before imaging and subsequent blinded analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were mounted with fluorescent mounting medium (Dako) between a glass slide and cover glasses.
-
bioRxiv - Neuroscience 2023Quote: ... with DAKO Fluorescent Mounting Medium (Agilent, cat. #S302380-2).
-
bioRxiv - Microbiology 2023Quote: ... mounted with DAPI-containing Fluorescent Mounting Media (Dako Omnis), and visualized using a LSM700 (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... cells were mounted with DAKO Fluorescent Mounting Medium (Agilent), and images were acquired using Leica microscopy systems (DMi8 and Thunder DMi8 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were mounted using fluorescent mounting medium (Dako). Imaging was performed using confocal microscopes (Olympus FV1200 and Nikon C1 ...
-
bioRxiv - Pathology 2024Quote: ... and mounted in Fluorescent Mounting Medium (S3023, Dako, Denmark). Images were acquired with Zeiss LSM700 (Zeiss ...
-
bioRxiv - Microbiology 2024Quote: ... filters were mounted in DAKO fluorescent mounting media (DAKO).
-
bioRxiv - Microbiology 2024Quote: ... coverslips were mounted in DAKO fluorescent mounting media (DAKO). Image acquisitions were realized using confocal laser scanning microscopy (Leica DMI6000 ...
-
bioRxiv - Plant Biology 2020Quote: ... Detection was by MS-TOF (Agilent 6220) in negative mode using electro-spray ionization ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by DAB chromogen detection (Dako, 3468) for IHC ...
-
bioRxiv - Cancer Biology 2024Quote: ... Blocking was performed in 0.03% H2O2 containing sodium azide for 5 minutes and primary antibodies (Table S1) were incubated for 60 minutes before detection (Dako EnVision+ System-HRP labeled Polymer) for 30 minutes and development for 5 minutes ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was carried out with the LSAB2 System-HRP (anti-rabbit/mouse LSAB2 Kit Dako Cat#K0679, dilution 1:100) or the VECTASTAIN Elite ABC HRP Kit (Vector Labs ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Cancer Biology 2021Quote: ... the slides were mounted with fluorescent mounting medium DAKO (Agilent) and left at +4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were mounted using Fluorescent Mounting Medium (DAKO, S302380-2). To label proliferating myoblasts ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were mounted using DAKO fluorescent mounting media (DAKO; S3023). Images were acquired using a Nikon Eclipse Ti spinning disk confocal microscope with a 20X air and a 60X oil immersion objective ...