Labshake search
Citations for Agilent :
101 - 150 of 2980 citations for 7H Pyrrolo 2 3 d pyrimidine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... for 5 minutes at room temperature and Oligo aCGH Wash Buffer 2 (Agilent) for 1 minute at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Biochemistry 2023Quote: Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting fatty acid methyl esters were analyzed using GC/MS (Agilent Technologies, Wilmington, DE) equipped with a capillary DB-23 column (30 m × 0.25 mm × 0.25 μm ...
-
bioRxiv - Microbiology 2022Quote: ... αIgG (Agilent Cat#A042402-2). Cells were cultured in RPMI-1640 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Physiology 2019Quote: ... ACC1/2 (DAKO DENMARK, P0397), phospho-ACC Ser212 (Millipore,03303).HDAC4 (7628 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the SureSelect Methyl-Seq Library Prep Kit ILM (Agilent Catalog # 5500-0128) included the indices for pooled sequencing ...
-
bioRxiv - Genomics 2023Quote: Eight library preparations were carried out using the SureSelect Methyl-Seq Target Enrichment kit (Agilent, G9651) following the manufacturer’s protocol (User guide ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Plant Biology 2021Quote: ... and 2% Buffer B (0.1% formic acid in Optima grade acetonitrile (Fisher)) using a 1200 series capillary pump (Agilent). Following loading ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2