Labshake search
Citations for Agilent :
101 - 150 of 4158 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counted and seeded (1×105 cells/well) onto poly-D-lysine-coated plates (Agilent), centrifuged at 200 × g for 3 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... For replicates 1 and 2 a Strategene Mx3005P PCR machine (Agilent, USA) was used ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies CD31 (1:200, M082329-2, DAKO), NG2 (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... followed by the addition of bluing buffer (Agilent, CS70230-2, 1 mL) and incubation at room temperature for 2 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and glial fibrillary acidic protein (GFAP) staining (1/1000; Dako Z033429-2), fixed samples were rinsed at RT with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... RRID:AB_2223021) were diluted 1:200 in Antibody Diluent (DAKO, cat.#S302283-2) and applied to cells overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 1:200 and anti-GFAP (Rabbit IgG polyclonal; Dako M076101-2). Secondary goat antibodies were Alexa Fluor conjugates (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... goat anti-rabbit IgG-HRP (1:3000, Agilent, cat no. P044801-2), for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... microglia-macrophages (Iba-1, Wako, #019-19741 and CD68, Dako, #M087601-2), oligodendroglia (Olig-2 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-rabbit or mouse horseradish peroxidase (HRP)-labeled secondary antibodies (1:4000, P044701-2 and P044801-2, Agilent) were added for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 200 µl min-1 and the digested peptides were captured on a 2 mm x 1 cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Pathology 2024Quote: ... the above IHC protocol was modified such that the anti-SARS-CoV-2 S primary antibody was at 1:1000 dilution (1 µg/mL) in background-reducing antibody diluent (Dako, S302283-2 ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was incubated with horseradish peroxidase-conjugated streptavidin (P0397; Dako; 1:3000, 3% BSA) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL was mixed with 3 µL D1000 sample buffer (Agilent Technologies, cat # 5190-6502) and run on Agilent 4200 TapeStation platform with D1000 screenTape (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... IdU) on alternate one-in-ten sections using different anti-BrdU antibodies from different vendors (for BrdU: 1/200, Dako, Glostrup ...
-
bioRxiv - Neuroscience 2020Quote: ... and retrovirus expressing EGFP in alternating one-in ten sections using different anti-BrdU antibodies from different vendors (for BrdU: mouse primary at 1/100, Dako; CldU ...
-
bioRxiv - Neuroscience 2024Quote: ... The section was subsequently incubated in primary antibodies (GFAP,1:1000, D1F4Q, Cell Signaling or CD79A, 1:200, M705001-2 DAKO or CD3, 1:100, A0452 DAKO), in BTHP-buffer (1% bovine serum albumin (BSA) ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 299.294 m/z (Methyl Stearate; Agilent article number G1982-85003) were used to recalibrate spectra during the acquisition.
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/600 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), and CD68 (ready-to-use ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/250 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), CD31 (ready-to-use ...
-
bioRxiv - Plant Biology 2023Quote: ... The ICP multi-element standard solution Intelliquant No.1 and 2 from Agilent were used for calibration using following concentrations ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: gp-insulin (Agilent/DAKO IR002, 1:2), mo-glucagon (Sigma-Aldrich #G2654 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: gp-insulin (Agilent/DAKO IR002, 1:2), mo-glucagon (Sigma-Aldrich #G2654 ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... the slides were washed with Gene Expression Wash Buffers 1 and 2 (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 × 105 CUTLL1 were plated per well on poly-D-lysine coated Seahorse XFe96 microplates (Agilent #101085-004) in XF RPMI medium (Agilent #103576-100 ...
-
bioRxiv - Physiology 2022Quote: ... [U-13C]-palmitate enrichment and [1,1,2,3,3-2H]-glycerol enrichment were measured by GC-MS/MS (Agilent GC model 7890A and Waters Quattro Micro) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed by NanoDrop ND-1000 (260/280 >2; ThermoScientific) and by RNA ScreenTape (RIN ≥7; Agilent). Samples were then sent to the TCAG Microarray Facility at Sick Kids Hospital (Toronto ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Bioengineering 2022Quote: ... Incubation with secondary antibodies diluted in blocking solution was performed 1 h at RT: anti-rabbit-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P044801-2; Dako, Carpinteria, CA, USA), anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent, #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...