Labshake search
Citations for Agilent :
101 - 150 of 3886 citations for 7 Oxabicyclo 4.1.0 hepta 2 4 diene 1 3 4 trifluoro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... or 1 µM (OMM1) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 µM of a rotenone antimycin A mix (Agilent Technologies). Following the assay ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasma (50 µL) was diluted with 150 µL of buffer A (1:4 dilutions, as recommended by Agilent Technologies), and then filtered to remove particulates using a 0.45 μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Developmental Biology 2019Quote: ... for one hour at room temperature and incubated overnight at 4°C with 1:200 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... High mass accuracy was achieved by infusion of 1:4 diluted ESI low concentration tune mix (Agilent Technologies, Waldbronn, Germany) at the start of each chromatographic run ...
-
bioRxiv - Developmental Biology 2021Quote: ... Half of the cDNA was amplified for 17 PCR cycles and a 1:4 dilution of the resulting library was assessed by Agilent Bioanalyzer High Sensitivity DNA kit ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed in 4% PFA and sequentially stained with mAbs to NPM (anti-human/mouse nucleophosmin (NPM) (clone 376, dilution 1:50, Dako) and anti-mouse MPO (Millipore) ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody incubation was performed overnight at 4 °C with rabbit monoclonal anti-PSyn EP1536Y diluted 1:320,000 in DAKO antibody diluent (Agilent #S0809). After three 5-min washes with PBST ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies diluted in blocking solution were incubated overnight at 4°C (anti-GFAP z0334 DAKO 1:400, anti-Iba1 019-19741 Wako 1:400). After three washes in PBS ...
-
bioRxiv - Physiology 2019Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:750, DAKO; diluted in 1% goat serum/PBS). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were then incubated overnight at 4°C with primary polyclonal anti-GFAP rabbit antibody (1:1000; Z0334, DAKO, Golstrup, Denmark) or anti-collagen IV rabbit antibody (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasma (50 μL) was diluted by adding 150 μL of Agilent buffer A (1:4 dilutions, as recommended by Agilent Technologies), then filtered using a 0.45μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... The Samples were diluted 4 fold with water and 1 μl supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
-
bioRxiv - Zoology 2020Quote: ... hydrated through graded ethanol and incubated overnight at 4°C with a mouse anti-human CD68 clone KP1 monoclonal antibody (1:100, Dako, Denmark). Then ...
-
bioRxiv - Immunology 2023Quote: ... pH 7.4) for 1 h without CO2 prior to measurement of O2 consumption and extracellular acidification rate (ECAR) by XFe24 (Seahorse Bioscience) with sequential addition of 1 μM of oligomycin ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Immunology 2022Quote: ... pooled at 4 nM and quality-assessed on a 2100 Bioanalyzer (Agilent Technologies). Sequencing was performed on an Illumina MiSeq (paired-end ...
-
bioRxiv - Cancer Biology 2020Quote: ... SureFISH chr4 CEP 613kb green for the centromere of chromosome 4 (#G101066G, Dako), FISH RAMP1 red for the RAMP1 gene (#G110996X-8 ...
-
bioRxiv - Immunology 2021Quote: ... Cy-dye labelling and hybridization to Agilent High Definition 4×44k array (Agilent technologies ...
-
bioRxiv - Physiology 2022Quote: ... We used a Mouse Gene Expression 4 × 44K Microarray chip (G4846A, Agilent Technologies), which can examine 23,215 genes as described [30] ...
-
bioRxiv - Immunology 2023Quote: ... mCTLA-4 cDNA was sub-cloned into the pCMV-Tag4A vector (Agilent Technologies) and an exon3 deletion construct was made by the KOD Plus Mutagenesis Kit (TOYOBO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with small RNA ladder (4-150nt) were used (cat no. 5067-1550, Agilent), all accessory reagents were also from Agilent (cat no ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then incubated overnight at 4°C with anti-CD4 (Dako) in a 1:10 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were next incubated overnight at 4°C with anti-PCNA antibody (DakoCytomation, clone PC10 ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... Lactate content was monitored using a Synergy 4 automatic microplate reader (Agilent BioTek) at 570 nm.
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: ... Nonspecific binding was minimized by incubating the sections with 4% Goat Serum (Agilent) for 30 min ...