Labshake search
Citations for Agilent :
101 - 150 of 533 citations for 7 CHLORO 1H INDOL 3 METHYLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: TP53 IHC was performed using monoclonal anti-TP53 antibody clone DO-7 (Dako, Carpinteria, CA, USA) using standard techniques described elsewhere57 on whole BM biopsy sections in a CLIA-certified laboratory ...
-
bioRxiv - Bioengineering 2022Quote: Dynamic release was performed using the 400-DS Apparatus 7 instrument (Agilent Technologies, Santa Clara, CA) at 37 °C in a 10 mL cell ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA with RNA Integrity Number (RIN) > 7 when assessed using the Agilent 2100 Bioanalyzer (Agilent, USA) were selected to move forward for further sequencing.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We quantified sample RNA quantity and quality (RNA integrity number > 7) on a Tapestation 2200 (Agilent) at the University of Montana genomics core ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescent images were obtained on a Keyence BZ-X710 microscope or on a Cytation 7 (Agilent).
-
bioRxiv - Physiology 2024Quote: MRI studies were performed using a 7-T Agilent/Varian scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2019Quote: MRI conducted at UT Southwestern was performed using a 7-Tesla small animal MRI system (Agilent Inc.) with a 40 mm (i.d. ...
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation as with the mitochondrial stress test astrocytes were transferred to XFmedia (Agilent) and glycolysis was assessed ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were incubated with primary antibodies for cytokeratin 7 (CK7; OV-TL 12/30,DAKO,Ready-to-Use), 3-mercaptopyruvate sulfurtransferase (MPST ...
-
bioRxiv - Genetics 2019Quote: ... and checked for a RIN number (≥ 7) to inspect RNA integrity by an Agilent Bioanalyzer 2100 (Agilent technologies). Qualified RNA was further purified by RNAClean XP Kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). Amplified cDNA libraries were constructed using SMART-seq v4 Ultra low Input RNA-kit (Takara ...
-
bioRxiv - Genomics 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). RNA was amplified using NuGen Ovation RNA amplification kit and sheared to an average size of 200 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Strand specific RNA sequencing was performed on quality controlled high RIN value (>7) RNA samples (Bioanalyzer Agilent Technologies). In brief ...
-
bioRxiv - Cancer Biology 2022Quote: ... in a citrate buffer for 20 min at 95°C for TP53 (1:800, Dako, M7001 DO-7), BCL-10 (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Foci were manually counted from images obtained on Cytation 7 plate reader (Agilent Life Sciences, Santa Clara, CA). For mosquito infectivity ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Genomics 2019Quote: ... We required a minimal RIN (RNA Integrity Number) of 7 as measured using a Bioanalyzer (Agilent, Santa Clara, CA) with the Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... the beads were transferred into a 1-mL PP filtration microplate (Agilent, 7 µm frit, cat. no. 202501-100) and washed 3x with 200 µL 1x PBS and 2x 200 µL ultrapure water ...
-
bioRxiv - Biophysics 2023Quote: ... 104 and 140) cDNA in pET-7 vector was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of four single cysteine mutants (T26C ...
-
bioRxiv - Physiology 2023Quote: ... RNA concentration and integrity (RIN>7 for all samples) was assessed via Qubit fluorometric quantitation and tapestation bioanalyzer (Agilent), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...