Labshake search
Citations for Agilent :
101 - 150 of 4099 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-CD68 (1:100, M081401-2, Dako Agilent Pathology Solutions), mouse anti-CD45 (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted at 1:10,000 with antibody diluent solution (DAKO, S080983-2), was also included as a positive control for the cell-based assay ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-CD68 (1:100, M081401-2, Dako Agilent Pathology Solutions), mouse anti-CD45 (1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... then primary antibody solution for Ki67 (#M724029-2, Agilent, 1:100) and NeuroD1 (#AF2746 ...
-
bioRxiv - Biophysics 2023Quote: ... an antibody mixture containing 1-part DAKO (Agilent, Cat#: S080983-2) and 4-parts goat serum was mixed to create a desired antibody dilution:
-
bioRxiv - Neuroscience 2024Quote: ... Hoechst33342 (Sigma, dilution 1/2 000 in Dako REAL Antibody Diluent) was applied for nuclear counterstaining ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Microbiology 2021Quote: ... For replicates 1 and 2 a Strategene Mx3005P PCR machine (Agilent, USA) was used ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies CD31 (1:200, M082329-2, DAKO), NG2 (1:200 ...
-
bioRxiv - Immunology 2019Quote: ... followed by SA-HRP (1:2000 dilution #P030701-2, DAKO – CA, USA) and visualised with TMB (#421101 Biolegend – CA ...
-
bioRxiv - Immunology 2021Quote: ... followed by the addition of bluing buffer (Agilent, CS70230-2, 1 mL) and incubation at room temperature for 2 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 1:200 and anti-GFAP (Rabbit IgG polyclonal; Dako M076101-2). Secondary goat antibodies were Alexa Fluor conjugates (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and glial fibrillary acidic protein (GFAP) staining (1/1000; Dako Z033429-2), fixed samples were rinsed at RT with PBS ...
-
bioRxiv - Genetics 2023Quote: ... goat anti-rabbit IgG-HRP (1:3000, Agilent, cat no. P044801-2), for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... RRID:AB_2223021) were diluted 1:200 in Antibody Diluent (DAKO, cat.#S302283-2) and applied to cells overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1/4 pear sections from 4 fruits per replicate) were injected into a HP 5890A gas chromatograph (Agilent, Avondale, PA, USA) with a flame ionization detector (FID ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 200 µl min-1 and the digested peptides were captured on a 2 mm x 1 cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Pathology 2024Quote: ... the above IHC protocol was modified such that the anti-SARS-CoV-2 S primary antibody was at 1:1000 dilution (1 µg/mL) in background-reducing antibody diluent (Dako, S302283-2 ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was incubated with horseradish peroxidase-conjugated streptavidin (P0397; Dako; 1:3000, 3% BSA) at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μL of TEDAP (4 μM) underwent reverse-phase HPLC (Agilent PLRP- S reversed phase column 3.0 μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/600 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), and CD68 (ready-to-use ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/250 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), CD31 (ready-to-use ...
-
bioRxiv - Plant Biology 2023Quote: ... The ICP multi-element standard solution Intelliquant No.1 and 2 from Agilent were used for calibration using following concentrations ...
-
bioRxiv - Immunology 2023Quote: ... the slides were washed with Gene Expression Wash Buffers 1 and 2 (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: gp-insulin (Agilent/DAKO IR002, 1:2), mo-glucagon (Sigma-Aldrich #G2654 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: gp-insulin (Agilent/DAKO IR002, 1:2), mo-glucagon (Sigma-Aldrich #G2654 ...
-
bioRxiv - Bioengineering 2021Quote: ... and incubated overnight at 4 °C with primary antibodies: Anti-GFAP 1:1000 (Z0334, Dako), Anti-CD68 1:400 (MCA1957 ...
-
bioRxiv - Immunology 2019Quote: ... 4°C overnight followed by HRP conjugated goat-anti-rabbit IgG (#P0448, Dako (1:1000). α-Tubulin was used as a housekeeping control (#sc-32293 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Bioengineering 2022Quote: ... Incubation with secondary antibodies diluted in blocking solution was performed 1 h at RT: anti-rabbit-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P044801-2; Dako, Carpinteria, CA, USA), anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000 ...