Labshake search
Citations for Agilent :
101 - 150 of 4502 citations for 7 Diethylamino 3 5 6 dimethyl 2 benzoxazolyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies CD31 (1:200, M082329-2, DAKO), NG2 (1:200 ...
-
bioRxiv - Immunology 2019Quote: ... followed by SA-HRP (1:2000 dilution #P030701-2, DAKO – CA, USA) and visualised with TMB (#421101 Biolegend – CA ...
-
bioRxiv - Immunology 2021Quote: ... followed by the addition of bluing buffer (Agilent, CS70230-2, 1 mL) and incubation at room temperature for 2 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 1:200 and anti-GFAP (Rabbit IgG polyclonal; Dako M076101-2). Secondary goat antibodies were Alexa Fluor conjugates (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and glial fibrillary acidic protein (GFAP) staining (1/1000; Dako Z033429-2), fixed samples were rinsed at RT with PBS ...
-
bioRxiv - Genetics 2023Quote: ... goat anti-rabbit IgG-HRP (1:3000, Agilent, cat no. P044801-2), for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... RRID:AB_2223021) were diluted 1:200 in Antibody Diluent (DAKO, cat.#S302283-2) and applied to cells overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... blocked for 1 hr in 2% BSA + 0.1% Tween20 + 1:50 normal goat serum (DAKO) in PBS and washed twice with PBS + 0.5% Tween ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-rabbit IgG (250 ng ml−1, 1% BSA in PBST; Agilent, P044801-2) or rabbit anti-goat IgG (500 ng ml−1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... αIgG (Agilent Cat#A042402-2). Cells were cultured in RPMI-1640 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Physiology 2019Quote: ... ACC1/2 (DAKO DENMARK, P0397), phospho-ACC Ser212 (Millipore,03303).HDAC4 (7628 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... and 0.25 μm film of 95% dimethyl/5% diphenylpolysiloxane) with a precolumn (10 m J&W integrated with Agilent 122-5532G) was used for compound separation ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Cell Biology 2023Quote: ... at 5 mM for 2 h or by UV irradiation at 20 mJ/cm2 using Stratalinker 1800 (Stratagene) followed by 2 h incubation at 37 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-goat IgG (500 ng ml−1, 1% BSA in PBST; Agilent, P044901-2), for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/600 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), and CD68 (ready-to-use ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/250 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), CD31 (ready-to-use ...
-
bioRxiv - Plant Biology 2023Quote: ... The ICP multi-element standard solution Intelliquant No.1 and 2 from Agilent were used for calibration using following concentrations ...
-
bioRxiv - Immunology 2023Quote: ... the slides were washed with Gene Expression Wash Buffers 1 and 2 (Agilent) according to the manufacturer’s instructions ...