Labshake search
Citations for Agilent :
101 - 150 of 2406 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... blocked and permeabilized with 5% goat serum (Dako) and 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm (Agilent Technologies, Santa Clara, CA, USA) under isocratic conditions (0.1 M sodium acetate buffer ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Biophysics 2021Quote: ... and endogenous peroxidase was blocked with 3% H2O2 in TBS for 5 min followed by incubation with anti-mouse EnVision+ labelled polymer (Agilent Technologies, Santa Clara, USA) for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... was amplified by PCR using cDNA of mouse kidney at the template with the primers 5′-CCGTCGACATGCAGGTCAAGAAATCCTG-3′ (SalI site in italics) and 5′-CCGGATCCTTAAAGGCGTGTGTGATCTT-3′ (M6 reverse primer; BamHI site in italics) and cloned into pBluescript SK(−) (Stratagene, La Jolla, CA, USA) using the SalI and BamHI sites ...
-
bioRxiv - Plant Biology 2024Quote: ... Oligosaccharides were reductively aminated with 2-aminobenzoic acid (2-AA) and cleaned using a GlycoClean S cartridge (ProZyme) as previously described (Tryfona & Stephens ...
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized and blocked in 5% goat serum (DAKO, X0907), 0.3% Triton-X-100 (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with a Bio SEC-5 2000 Å guard (Agilent). The mobile phase was PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 μl SYBR green (Agilent Technologies, CA, United States), and 2 μl nuclease-free water ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... equipped with a VF-5 ms column (Agilent Technologies) of 30 m length ...
-
bioRxiv - Immunology 2023Quote: Images were acquired with a Biotek Cytation 5 (Agilent) and images were analyzed with Biotek Gen5 software ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5’ and mounted with fluorescent mounting medium (Dako). The Lmx1a antibody detection capability was improved using the Tyramide Signal Amplification kit (TSA ...
-
bioRxiv - Bioengineering 2024Quote: ... Sections were imaged using Biotek Cytations 5 (Agilent Technologies).
-
bioRxiv - Microbiology 2024Quote: ... and luminescence measured on a Cytation 5 instrument (Agilent). The luminescence inhibited by Z-YVAD-FMK corresponds to specific caspase-1 activity ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Microbiology 2024Quote: ... in digital wide-field microscopy (BioTek Cytation 5, Agilent). Automated Image capturing was performed at 10 minute intervals using a 10X objective and the BioTek Gen5 Software ...
-
bioRxiv - Molecular Biology 2024Quote: ... and analyzed by Cytation 5 (Agilent, CA, United States). Cells seeded in 6-well plates were used for PCR or Western Blotting.
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence was measured using the Cytation 5 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Biophysics 2022Quote: ... 1 and 3.5 μm diameter fibers were manufactured from 2 and 5 wt% of high molecular weight polystyrene (MW: 15,000,000 g/mol, Agilent Technologies, Santa Clara, CA, USA) and equally spaced at approximately 60 μm ...
-
bioRxiv - Plant Biology 2023Quote: ... Ten-μl B314-2 sample was injected into an Eclipse XDB-C18 column (250 mm x 4.6 mm, 5 μm, Agilent, Santa Clara, CA, USA) and eluted with the same gradient solvent system described above ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... Coverslips were then incubated with 1X DAPI for 5 min before mounting on slides using DAKO mounting media (Agilent Technologies, Cat #S302380-2). Images were captured at 60X or 100X using a Nikon C2+ confocal microscope coupled to NIS-Elements AR software (Nikon).
-
bioRxiv - Microbiology 2024Quote: ... Grids were then washed with PBS and blocked with 1% FBS for 5 min Grids were subsequently incubated with rabbit anti-CEA (Dako, supplemental table 2) for 30 min ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1000 x g for 5 minutes and resuspended in 2 mL of assay media (Seahorse XF base medium without phenol red (Agilent, Cat. # 103334-100), 1 mM pyruvate (Acros Organics ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...