Labshake search
Citations for Agilent :
1351 - 1400 of 6060 citations for Cow Ataxin 10 ATXN10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... samples were subjected to a treatment with 0.3% Sudan black solution for 10 min prior to blocking for 2 h (Dako Blocking Solution X0909 ...
-
bioRxiv - Neuroscience 2020Quote: ... incubated with DAPI (1:10’000) to label nuclei for 10 min and mounted using Fluorescence mounting medium (Dako, S3023). Fluorescent images were recorded with a Leica SP5 Confocal Microscope.
-
bioRxiv - Cell Biology 2021Quote: ... FACS sorted MPs were plated on XF96 cell culture microplates coated with 10% Matrigel in warm assay medium (Agilent), the cell culture plate was centrifuged with 200 g for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS and 10% Methanol for 10 min and incubated overnight with the primary antibody (Table 2) in PBS/T 0.1 with 10 % normal swine/ goat or rabbit serum (Dako). Second ...
-
bioRxiv - Molecular Biology 2021Quote: ... In TTBS rinsed slides were blocked for 10 min at room temperature using DAKO peroxidase blocking solution (#S200230, Dako), washed again in TTBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The desalted large peptide mixture was separated by a home-packed PLRP column (PLRP-S, 200 mm length x 500 μm i.d., 10 μm particle size, 1,000 Å pore size, Agilent) in a 63-min gradient from 10% to 90% mobile phase B (mobile phase A ...
-
bioRxiv - Bioengineering 2020Quote: ... VO2max = 1.04×10−16 mol/s/cell was measured for hiPSC-Heps using the Seahorse XF24 cellular respirometer (Agilent) (see ...
-
bioRxiv - Immunology 2021Quote: ... for 10 minutes at 37°C for F4/80 or blocked with a protein block (catalog number x0909, Dako) for 10 minutes followed by an Fc block (catalog number 553142 ...
-
bioRxiv - Biochemistry 2022Quote: ... The gas chromatograph was equipped with a DB-5 ms column (30 m × 0.25 mm, film thickness 0.25 μm; including 10 m DuraGuard column, Agilent Technologies) and a GC inlet liner (ultra inert ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were washed with PBS 1X for 10 mins and coverslipped with Dako fluorescence mounting medium (Dako North America).
-
bioRxiv - Evolutionary Biology 2022Quote: ... and equipped with a VF-5ms column (30 m × 0.25 mm × 0.25 μm, with 10 m EZ-guard column, J&W Agilent Technologies). For the analysis of CHCs ...
-
bioRxiv - Cell Biology 2019Quote: ... then permeabilized with PBS 0.25% triton X-100 for 10 minutes and blocked by a 20 minute incubation in DAKO block (Agilent). BrdU was detected by incubation with anti-BrdU (ICR1 ...
-
bioRxiv - Genomics 2020Quote: ... The coverslips were incubated with 10 μL mixture of a custom probe set targeting a selected DNA locus (Agilent) and SureFISH Hybridization Buffer (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... N≥50 worms (10 worms/ well) were transferred to the Seahorse XF96 Cell Culture Microplate (Agilent Technologies, 101085-004) in a total volume of 180 uL ...
-
bioRxiv - Neuroscience 2019Quote: Fractions were reconstituted in 10% FA and analyzed in two technical replicates with a UHPLC 1290 system (Agilent technologies) coupled to an Orbitrap Q Exactive X mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: ... From each sample 10 µl was injected onto a SEC-3 HPLC column (300 Å pore size; Agilent Technologies) equilibrated with HKMC at a flow rate of 0.3 ml/min ...
-
bioRxiv - Genetics 2020Quote: ... We determined efficiency of each reaction using the equation Efficiency = −1+10(−1/slope of standard curve) (Agilent Genomics). We additionally calculated ratios of transcript abundance to determine expression levels of one gene relative to another gene and to account for any differences in underlying mRNA levels among individuals ...
-
bioRxiv - Biochemistry 2021Quote: A serum volume of 10 µL was diluted ten times with load/wash buffer solution (Agilent Cat.#: 5185-5987). Each sample was filtered through a 0.22-μm spin filter (Agilent Cat.# ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8–10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Immunology 2022Quote: ... and a 1:10 dilution of the resulting cDNA was run on a Fragment Analyzer (Agilent Technologies #5067-4626) to assess cDNA quality and yield ...
-
bioRxiv - Microbiology 2022Quote: ... We then amplified 3 µL of cDNA (10 ng/µL) in Power SYBR (Thermo) with 1.6 µM primers using the AriaMx real-time PCR system (Agilent) in a volume of 12 µL ...
-
bioRxiv - Microbiology 2022Quote: ... contained a fused-silica fibre of 80μm x 10 mm coated with a layer of divinylbenzene–carboxen–polydimethylsiloxane (DVB/CWR/PDMS) (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent] ...
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... the buffer was exchanged into basic PBS (pH 8.0) with 0.1 % Tween-20 for a 2 h conjugation with 10 µM streptavidin (Prozyme, SA10) and 10 µM fluorescent dye (Lissamine Rhodamine B ethylenediamine ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the assay medium was prepared by supplementing Seahorse XF Base medium (pH 7.4) with a specific combination of 10 mM glucose (100X stock, Agilent), 1 mM pyruvate (100X stock ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cancer Biology 2022Quote: PBMs were performed on universal ‘all 10-mer’ arrays in 8 x 60K format (GSE AMADID # 030236, Agilent Technologies) essentially as described previously (Berger and Bulyk 2009 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The protein (10 μL) was loaded by an LC system (Agilent 1290 Infinity II, Agilent Technologies, Santa Clara, CA) on a HPLC column (PLRP-S 1000 Å ...
-
bioRxiv - Cancer Biology 2023Quote: ... intact poly(A) RNA was purified from 100-500 ng of RNA (RIN 8-10, Agilent Technologies 2200 TapeStation) with oligo(dT ...
-
bioRxiv - Immunology 2023Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8-10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... Secreted protein in cell culture media was enriched using StrataClean Resin (Agilent, 10 µl per 5 ml of media) as previously described37 ...
-
bioRxiv - Bioengineering 2024Quote: ... A 10% solution of mTG in PBS was prepared and filtered through a 0.45 μm syringe filter (Agilent Technologies). The final concentration of mTG was 10 U/g (enzyme/gelatin) ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Oxygen consumption rates (OCR ...
-
bioRxiv - Plant Biology 2020Quote: ... pAD-WT and pBD-WT from the HybriZAP 2.1 kit (Stratagene, USA) were used as a control of positive interaction (C+) ...
-
bioRxiv - Biophysics 2021Quote: ... a tile system was created using the Quikchange Lightning Multi kit (Agilent), as reported earlier (Kozek et al. ...
-
bioRxiv - Biophysics 2020Quote: ... using the QuikChange II site directed mutagenesis kit (Agilent, Santa Clara, CA) with primers purchased from Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... staining was revealed using the IDetect Super strain HRP polymer kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and sizing was determined by Fragment Analyzer HS Small Fragment Kit (Agilent). A smear analysis was conducted in the range of 150 to 1000 bp ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR mutagenesis was performed using QuickChange II site directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Site-directed mutagenesis was performed using Quikchange Lightning mutagenesis kit (Agilent Technologies) and pEGFP-c1 hsOCRL1 (wild-type ...
-
bioRxiv - Cell Biology 2020Quote: ... and Agilent G1607A CE-ESI-MS sprayer kit (Agilent Technologies, Waldbronn, Germany). The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... we used the Low-Input QuickAmp kit (Agilent, Santa Clara, CA, USA). The resulting cRNA was purified using the Absolute RNA Nanoprep kit (Agilent) ...