Labshake search
Citations for Agilent :
1351 - 1400 of 1541 citations for 7 chloro 4 oxo 4H chromene 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Plant Biology 2023Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Immunology 2024Quote: ... The membranes were washed and incubated at room temperature for 1 h with rabbit anti-mouse IgG (Agilent, P026002-2) or goat anti-rabbit IgG (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies diluted in blocking solution were incubated overnight at 4°C (anti-GFAP z0334 DAKO 1:400, anti-Iba1 019-19741 Wako 1:400). After three washes in PBS ...
-
bioRxiv - Physiology 2019Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:750, DAKO; diluted in 1% goat serum/PBS). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Biochemistry 2019Quote: ... The mixtures of standards were dried under vacuum using a vacuum rotation evaporator (Extractor Plus®, Agilent, settings: 30°C, 4 h, 1000 rpm, VAQ).
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Microbiology 2020Quote: ... Sample quality control was assessed using a Qubit 4 Fluorometer (using Qubit™ dsDNA BR assay Kit) and Agilent 2200 TapeStation (using Agilent D5000 ScreenTape assay kit). Library construction and sequencing was undertaken at Novogene (Beijing ...
-
bioRxiv - Cancer Biology 2022Quote: ... explants treated with BrdU substrate for 24 hours prior to fixation as described in Section 6.3.1) (DAKO, Cat. M0744; 1:50 overnight at 4 °C), cytokeratin (DAKO ...
-
bioRxiv - Biophysics 2021Quote: ... 7.8 mm ID x 300 mm column equilibrated in GF150 buffer (25 mM HEPES-KOH, 150 mM KCl, 2 mM MgCl2) plumbed into an HPLC (Agilent 1100). Molecular masses were analyzed by an inline SEC-MALs system (Wyatt Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 RBD constructs carrying point mutation were generated by following the standard protocol from QuikChange® II XL Kit (Agilent). The cloned genes were sequenced to confirm that no errors had accumulated during the PCR process ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell viability was assessed by measuring the absorbance at 570 nm wavelength using Epoch 2 microplate spectrophotometer (Agilent technologies. USA).
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies against proliferating cell nuclear antigen (PCNA-1, 1/200, sc-7907, Santa Cruz; PCNA-2, 1/200, M087901, Dako) were applied overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The single layer supernatant was pipetted into separate 2 mL screw cap amber-glass autosampler vials (Agilent Technologies, Cheadle, United Kingdom); being careful not to break up the solid pellet at the bottom of the tube ...
-
bioRxiv - Neuroscience 2021Quote: ... TUJ1 (Covance) and CMTM5 (custom made by Pineda, Berlin, Germany Table 2) antibodies were diluted in antibody diluent (DAKO, Hamburg, Germany) and incubated for 48 hours at 4°C in a dark ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Genomics 2019Quote: ... fragments with UMIs were generated using 200 ng starting material (purified by ethanol precipitation) in 2 cycles of PCR with Herculase II Fusion DNA Polymerase (Agilent Technologies) using an equimolar mixture of P023poolseqNN-primers (1 mM final concentration ...
-
bioRxiv - Developmental Biology 2019Quote: ... truncated and deletion versions of RAB13 3’UTR were generated by PCR using 0.3 μM sequence-specific primers (Extended Data Table 2) and Platinum Pfx DNA polymerase or using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions and introduced into the pcDNA3-HBB-24XMS2SL-MCS using the NheI and XhoI sites.
-
bioRxiv - Microbiology 2021Quote: ... The RNA was then cross-linked to positively charged membranes using a UV-crosslinker (Stratagene UV Stratalinker 2400, 2×240 mJoules) and stained with methylene blue (SERVA ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Biochemistry 2020Quote: ... Radioactivity was detected using an in-line Lablogic Radiodetector and the analysis was calibrated using a co-injected 2-aminobenzamide-labeled dextran ladder (ProZyme/Agilent) detected on a Dionex fluorescence detector.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were further diluted with ultrapure water to a final concentration of 2% HNO3 and subjected to ICP-MS on Agilent 7700 ICP-MS (Agilent Technologies). ICP-MS runs were calibrated with high-purity iron standard solution (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 µL of purified PKD1KD at 2 mg/mL was injected onto an S200 10/300 column (Cytiva) connected to a 1260 Infinity HPLC (Agilent Technologies). A MiniDawn Treos (Wyatt ...
-
bioRxiv - Cancer Biology 2021Quote: ... W503F (PBD, polo-box domain 1) and H629A, K631M (PBD, polo-box domain 2) were generated by site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... embedded in paraffin, and automatically stained for SARS-CoV-2 (2019-nCoV) Nucleocapsid (SINO BIO, #40143-R019) or for fibrin (DAKO, #A0080) through LEICA BOND RX 1h room- temperature (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Immunology 2020Quote: ... by placing the virus for 2 minutes in a UV Stratalinker 2400 equipped with 365 nm long-wave UV bulbs (Stratagene, USA). UV-inactivation was confirmed by lack of cytopathic effect on BSC-1 cells infected with i-VACV for up to 3 days (data not shown).
-
bioRxiv - Biochemistry 2021Quote: ... was added to a final concentration of 0.5% along with 2 µL of PNGase F Ultra (Agilent Technologies, Santa Clara, CA) and incubated for 1 hour at 37 °C before subsequent 2-AB/2-AA labelling ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples for both the high pressure experiment and ambient pressure control experiment were prepared in 2 mL glass headspace vials (Agilent Technologies) whose caps were pierced with a needle.