Labshake search
Citations for Agilent :
1301 - 1350 of 8406 citations for ST2 Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The quality of libraires was assessed by Agilent DNA 1000 kit (Agilent, Cat# 5067-1504)) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Physiology 2024Quote: ... using the RNA 6000 Nano Kit (Agilent). For RNA-Seq and qPCR analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... The QuikChange site-directed mutagenesis Kit (Stratagene) was used to generate the Aq ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2100 BioAnalyzer D1000 kit (Agilent 50671504) and Illumina MiSeq Nano v2 QC.
-
bioRxiv - Microbiology 2024Quote: ... using the High Sensitivity DNA Kit (Agilent). The total DNA for each sample was fragmented using the ultrasonicator Covaris S220 (Covaris Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the RNA 6000 Nano kit (Agilent) or TapeStation with the Agilent RNA ScreenTape assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the RNA 6000 Nano kit (Agilent). Samples for sequencing were subject to rRNA depletion and library preparation by Illumina Truseq kit ...
-
bioRxiv - Immunology 2021Quote: ... a monoclonal mouse antibody against the intracellular tail of human HLA-DR α chain was used (Clone TAL.1B5, # M0746, Agilent, Santa Clara, CA, USA). Detection of MHC-I on the surface of cells was performed using a monoclonal mouse antibody against devil beta-2-microglobulin (B2M ...
-
bioRxiv - Genetics 2021Quote: ... and cultured chondrocytes of children (six girls and six boys) using catalog one-color microarrays (SurePrint G3 Human Gene Expression microarray, 8 × 60 k format; Agilent Technologies, Santa Clara, CA, USA). The data were analyzed using GeneSpring software (version 14.9 ...
-
bioRxiv - Microbiology 2019Quote: ... EV suspensions were stained with a cocktail of fluorescence-conjugated mAbs (PerCP/Cy5.5-anti-human-CD63, clone H5C6 from Biolegend; RPE-CD11b from Dako; and FITC-Annexin V from Biolegend) for 20 min at RT and centrifuged on 45° fixed angle rotor FA-45-30-11 (Eppendorf ...
-
bioRxiv - Cancer Biology 2023Quote: ... the expression of 2,459 mature miRNAs was investigated by the microRNA microarray analysis using SurePrint G3 8×60K Human miRNA Microarray chips (AMADID 70156; Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Pathology 2024Quote: Consecutive 4-μm slices of human-aspirated thrombi were immunohistochemically stained using antibodies against glycophorin A (erythrocyte marker, mouse monoclonal antibody, clone JC159; Dako/Agilent, Santa Clara, CA, USA), fibrin (mouse monoclonal antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (NeuN, 1:20,000, Millipore, MAB377B; CD68, 1:1,000, Serotec, MCA1957S; GFAP, 1:10,000, Dako Z0334) were diluted in 0.3% Triton X in PBS and incubated for 12 hours at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA quality control measurement was done using the High Sensitivity RNA Kit and RNA 6000 Nano Kit (Agilent Technologies). Ovation® RNA-Seq System V2 (NuGEN ...
-
bioRxiv - Microbiology 2020Quote: ... The quantity and size distribution of the RNA and DNA were determined by Agilent Bioanalyzer 2100 with an RNA 6000 Pico Kit and a DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2019Quote: ... The RNA was DNase treated using Turbo DNA free kit according to manufacturer’s protocol (Thermo Fischer scientific) for making cDNA using Accuscript hi-fidelity cDNA synthesis kit (Agilent). The qRT-PCR was set up using brilliant III ultra-fast SYBRgreen qPCR master mix in Mx3005P qPCR system Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... Site-directed NS1 mutants were produced using a site-directed mutagenesis kit (QuikChange XL Site-Directed Mutagenesis Kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD21 (DAKO, 1:25, CD23 (Leica, CD23-1B12, 1:50), CD4 (DAKO ...
-
bioRxiv - Cell Biology 2019Quote: ... progesterone receptor (CST 8757, 1:25; Dako A0098, 1:20), estrogen receptor (Santa Cruz sc-542 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Ki67 (1:50, clone MIB-1, Dako, M7240), mouse anti-INSR (1:50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 mouse (DAKO, clone MIB-1, 1:50); Anti-Ki-67 rabbit (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Biolegend, 829401, 1:1500 and Dako, Z0334, 1:1500), Nestin (Aveslabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... thyroid transcription factor (TTF-1) (mouse, M3575, 1:100; Dako), and p40 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... stained for H&E and HSV-1 (1:1000, Dako), and analyzed by a veterinary pathologist (Dr ...
-
bioRxiv - Immunology 2022Quote: ... 3×105 cells from each donor were plated per replicate in DMED media adjusted to a pH of 7.4 in a p96 well plate (Seahorse XFe96 FluxPak Agilent Technologies 102416-100) in the presence of 0.125 mM Sodium pyruvate ...
-
bioRxiv - Systems Biology 2021Quote: ... Sample fractions were continuously collected into 96 well plates by an Agilent 1100 Series Micro-FC G1364D micro fraction collector (Agilent Technologies, Germany). For each sample ...
-
bioRxiv - Immunology 2023Quote: ... following standard protocol and plated at a concentration of 2×105 cells per well of a seahorse XFe96 assay plate in seahorse XF DMEM media (Agilent; 103575-100) supplemented with 1mM pyruvate ...
-
bioRxiv - Molecular Biology 2023Quote: ... seedlings were exposed on the plates to 8 kJ/m2 UV-C light in a Stratalinker 2400 (Stratagene, La Jolla, California, US) and transferred back into growth chamber for 5 h ...
-
bioRxiv - Neuroscience 2023Quote: Human iPSC-derived motor neurons were differentiated according to the homogenous protocol and seeded at day 10 into Seahorse XF96-well plates (Seahorse Bioscience, Agilent Technologies). At day 21 the plates were washed and incubated for 60 min in an air incubator at 37 °C with Seahorse DMEM-based assay medium ...
-
bioRxiv - Biophysics 2023Quote: Assessment of the extent of protein oligomerization was based on monitoring absorbance at 550 nm using BioTek Plate Reader (Agilent BioTek NEO2) to reflect turbidity changes induced by protein oligomer formation ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent, 204495-100) containing the HB95 cross-linked beads ...
-
bioRxiv - Systems Biology 2024Quote: Media to be used for cultivating cells for intracellular metal quantification with ICP-MS was through a PVDF membrane plate (Agilent 200931-100) into fresh deep-well (2mL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... A 470 µL aliquot of pre-mixed solution without TQ was transferred to a 96-well plate (Agilent Technologies, Santa Clara, USA) three wells (n = 3) ...
-
bioRxiv - Immunology 2024Quote: ... beads were washed twice with 200 µL PBS-TBN buffer using an Agilent BioTek 405 TS Microplate Washer magnetic plate separator (Agilent Technologies, USA). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... (Clones #87 and #160) cultured in COMMA1D media were seeded in 22 wells of a Seahorse 96-well plate (Agilent #103792-100) at a density of 15,000 cells per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated with the required primary antibody (ABri: 338 1:1000 from Ghiso lab; ADan: 5282 1:1000 from Ghiso lab; CD68: 1:150 DAKO; CR3/43: 1:100 DAKO) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...