Labshake search
Citations for Agilent :
1301 - 1350 of 4557 citations for 6 chloro 2 N 2 N diethyl 4 N propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The spinal cord tissue was dissected and packed into a 4 mm zirconium rotor (Agilent Techonology Inc., CA, USA) with 50 μL of D2O saline (0.9% ...
-
bioRxiv - Microbiology 2021Quote: ... and Tyr 254 in TlpALBD were generated via site-directed mutagenesis of pBH4_TlpALBD with primers listed in Supplemental Table 4 (QuikChange, Stratagene). TlpALBD and all point mutants were purified as described by Sweeney et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and C21 was accomplished using a C18 Security guard cartridge (4.6 × 4 mm) and Zorbax Extend-C18 column (4.6 × 75 mm, 3.5 μm, Agilent 766953-902) at 40 °C (mobile phase A = H2O + 0.1% formic acid ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Physiology 2024Quote: ... Sections were fixed with 0.2% glutaraldehyde + 4% PFA and mounted with Glycergel Mounting Medium (Agilent Technologies, Santa Clara, CA). The antisense probe generated with T7 polymerase showed the specific signal ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated overnight at 4°C with primary antibodies in DAKO REALTM Anti-body diluent (Agilent, Cat#S2022). Secondary antibodies (1:500 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2024Quote: ... 4 technical replicates for each time point were analysed using Microwave Plasma - Atomic Emission Spectrometry (MP-AES 4210, Agilent) as reported previously24.
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... citrate pH 6 (Agilent Technologies). Slides were immersed with blocking solution (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were incubated with the indicated primary antibodies (Reagents) overnight at 4 °C followed by Envision/diaminobenzidine detection (Dako, Glostrup, Denmark) and hematoxylin counterstaining/mounting (Entellan ...
-
bioRxiv - Cell Biology 2019Quote: ... solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako) at room temperature for 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... at 4 °C overnight and immunostained using the streptavidin-biotin peroxidase technique (Envision universal peroxidase kit; Dako Cytomation, Milan, Italy). After incubation ...
-
bioRxiv - Cell Biology 2019Quote: ... solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to a nitrocellulose membrane before probing using a primary anti IL-36γ antibody (Biotechne (R&D) UK) overnight at 4°C and a secondary goat antibody (Dako) for 1 hour at room temperature to visualise any protein cleavage.
-
bioRxiv - Biochemistry 2020Quote: The supernatants of the quenched in vitro OMT reactions and fermentation samples were analyzed by reversed-phase HPLC (instrument: Agilent 1100; autosampler: HiP sampler G1367A, T=4°C, 10 μL injection; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Microbiology 2020Quote: ... and pCMVTag 4 expression control plasmid containing the firefly luciferase gene fused with the FLAG tag (luc-FLAG) were obtained from Stratagene. The plasmid 15cxCAT contained the interleukin-2 (IL-2 ...
-
bioRxiv - Genomics 2021Quote: ... 4 μl of the purified product were amplified in multiple 100 μl reactions using Herculase II Fusion DNA Polymerase (Agilent) following the manufacturer’s specifications with 0.3 μM of the IS5/IS6 primers ...
-
bioRxiv - Genomics 2021Quote: ... and electroporated in five separate cuvettes containing 4 µL of the plasmid and 40 µL of ElectroTen-Blue electrocompetent cells (Agilent). After a 1 hr outgrowth in Luria Broth (LB ...
-
bioRxiv - Molecular Biology 2021Quote: ... iPSC-derived kidney organoids were cut at a thickness of 4 μm using a cryo-microtome and mounted on FLEX IHC Microscope Slides (DAKO, Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each RNA sample was processed with fluorescence-labelling to prepare complimentary RNA (cRNA) targets that could be detected by an SBC human ceRNA array V1.0 (4□×□180K, Agilent Technologies). The microarray kit contained 88,371 circRNA probes and 18,853 mRNA probes ...
-
bioRxiv - Microbiology 2022Quote: ... esters and 4-vinyl guaiacol concentrations were analysed using headspace solid phase micro-extraction coupled with gas chromatography (Agilent 7890A)- mass spectrometry (Agilent 5975C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tissue sections were incubated with 4% bovine serum albumin (BSA) and 8% serum in 1x wash buffer ‘en vision’ (Dako) to eliminate non-specific protein binding sites ...
-
bioRxiv - Immunology 2020Quote: Extracts and 4-OHE1 standard were analyzed using a liquid chromatography system (LC; 1200 series, Agilent Technologies, Santa Clara, CA) that was equipped with a reversed-phase analytical column (length ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were imaged using a 60x Plan Apo 1.4 NA objective on a Nikon Ti2-E microscope with a Yokogawa X1 spinning disk confocal system, MLC400B 4-line (405nm, 488nm, 561nm, and 647nm) dual-fiber laser combiner (Agilent), Prime 95B back-thinned sCMOS camera (Teledyne Photometrics) ...
-
bioRxiv - Microbiology 2022Quote: ... One hundred μL of the extract was mixed with 10μL of 4-chlorobenzotrichloride as injection standard and analyzed by GC (HP 7890 Series GC, Agilent, USA) with a 20 m 0.18mm (18μm film thickness ...
-
bioRxiv - Cell Biology 2022Quote: ... Plates were immediately centrifuged at 2 000 x g for 20 min at 4 °C and left on ice until insertion into the Seahorse XFe96 Analyzer (Agilent) after the cartridge plate calibration cycle on the analyzer was complete ...
-
bioRxiv - Cancer Biology 2023Quote: ... The adapter-modified DNA fragments were enriched by 4 cycles of PCR using SureSelect forward and SureSelect ILM Pre-Capture Indexing reverse (Agilent) primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated with Alamar Blue for 3-4 hours and then imaged with a Synergy Neo plate reader using excitation: 550 nm and emission: 590 nm (Agilent). The average plate background (media only with 0.1% DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... This system makes it possible to culture many bacterial strains in parallel in a replicated manner using many 96-well plates which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Pathology 2023Quote: ... consecutive 4-μm slices of human aspirated thrombi were immunohistochemically stained using antibodies against CD34 (mouse monoclonal, clone QBEnd10; Dako/Agilent), FXI (LSBio) ...
-
bioRxiv - Microbiology 2023Quote: ... Growth curves of OD578 were monitored every hour after 1 min of linear shaking under anaerobic conditions using an Epoch2 microplate reader coupled with a Biostack 4 microplate stacker (both Agilent) housed in a custom-made incubator (EMBL workshop24) ...
-
bioRxiv - Plant Biology 2023Quote: ... Temperature-dependent phase transition was detected by measuring the optical disturbance at 800 nm by increasing the temperature from 4 to 60°C (with a ramping rate of 0.5°C/min) using a spectrophotometer Cary 300UV-VIS (Agilent Technologies). Nitrogen gas purging was used to prevent the moisture from condensing on the cuvette surface.
-
bioRxiv - Biochemistry 2024Quote: ... and 3D z-stacks were taken of each replicate well monitored every 4 hours for 48 hours using a Cytation C10 imager (Agilent) with confocal 546 nm excitation laser ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.