Labshake search
Citations for Agilent :
1301 - 1350 of 3968 citations for 6 BROMO 4 4 DIETHYL 1H BENZO D 1 3 OXAZINE 2 4H THIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were read at 450 nm and 560 nm wavelengths using a BioTek Cytation 3 Cell Imaging Multi-Mode Microplate Reader (Agilent Technologies). Plasma samples isolated from retroorbital bleeds were used for ProcartaPlex immunoassays (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2020Quote: ... Blots were washed three times with TBST for 15min at room temperature and subsequently incubated for 2h at room temperature with HRP-conjugated secondary antibodies (goat anti-rabbit, Dako; rabbit anti-goat, R&D Systems) at a dilution of 1:5000 in TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP (1:200, rabbit, Dako; 1:1000, chicken, Millipore), MBP (1:500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... clone MIB-1 (diluted 1:100; DAKO, Carpinteria, CA) at 4°C overnight ...
-
bioRxiv - Pathology 2020Quote: ... anti-HER2 (1:400 to 1:600, DAKO, Denmark), anti-PR antibody (DAKO ...
-
bioRxiv - Neuroscience 2023Quote: ... Iba1 (1:1,000, Wako) and GFAP (1:1,000, Dako) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... for which tissues was treated with heated Target Retrieval Solution pH 6.1 (S169984-2, Dako) for 30 min) ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue sections −1.70 mm from Bregma were mounted onto microscope slides (Dako, Cat# K802021-2), allowed to dry upright for 30 min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Labeled DNA was hybridized to a custom ChIP-on-Chip 2×105K microarray (Agilent G4498A), designed with 102,839 60-nucleotide probes tiled across the K ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antigen retrieval was performed by boiling slides immersed in Target Retrieval Solution (DAKO, S169984-2) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent), following the respective manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg amplified cDNA was Cy3-labeled using the SureTag DNA labeling kit (Agilent Technologies). The Cy3-labeled DNA was hybridized overnight to 8×60K 60mer oligonucleotide spotted microarray slides (Agilent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions, Santa Clara, CA), fibronectin (2 μg/ml clone MAB1918 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 ng DNA was transformed into the Validation Reporter (VR) strain (Agilent Technologies #200192; discontinued) to obtain 30-40 million transformants using electroporation ...
-
bioRxiv - Pathology 2021Quote: ... we employed Dako Liquid DAB + Substrate Chromogen System® (cat. K346811-2, Agilent Technologies Inc.), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Samples (2 µL) were injected into a 7890B GC/5977A GC/MSD system (Agilent Technologies) with a DB-Wax capillary column (60 m length ...
-
bioRxiv - Neuroscience 2021Quote: ... HRP-conjugated polyclonal antibody (goat anti-rabbit) is purchased from DakoCytomation (Glostrup, Denmark; D048701-2). Mouse LH reference prep (AFP5306A ...
-
bioRxiv - Neuroscience 2021Quote: ... CD20 (monoclonal mouse – anti-human CD20 IgG2a, clone L26, cat. no. M075501-2, Agilent Technologies), 1:800 ...
-
bioRxiv - Immunology 2022Quote: ... 100 mM 2-DG using a 96-well extracellular flux analyzer XFe-96 (Seahorse Bioscience).
-
bioRxiv - Neuroscience 2022Quote: ... for 30 min at RT and peroxidase activity was revealed using DAB+ (Dako, K346811-2). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... and by (2) capillary electrophoresis on Fragment Analyzer (Agilent, HS Large Fragment Kit DNF-493). The quality control of gHMW DNA before degradation showed a DNA concentration of 10 ng/µL ...
-
bioRxiv - Neuroscience 2022Quote: ... Endogenous peroxidase was blocked using a ready-to-use peroxidase-blocking solution (S202386-2, Dako). The primary antibody was diluted in antibody diluent (S080983-2 ...
-
bioRxiv - Physiology 2022Quote: ... An Iron Stain Kit was used to identify iron pigments (AR15811-2, Artisan, Dako, Agilent) and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2 ...
-
bioRxiv - Physiology 2022Quote: ... An Iron Stain Kit was used to identify iron pigments (AR15811-2, Artisan, Dako, Agilent) and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... after which it was read at 595 nm in Epoch 2 Microplate Spectrophotometer (Biotek/Agilent). The standard curve was constructed using BSA dilutions ranging from 125 to 1,000 µg/mL (Quick Start Bovine Serum Albumin Standard ...
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... for 2 hours at RT before mounting them in clear mounting medium (DAKO, cat#S3023). We imaged fluorescent signals of mounted brain sections under a scanning microscope (ZEISS ...
-
bioRxiv - Immunology 2023Quote: ... and 2 min hold time at each temperature using Stratagene DSF Instrument (Agilent, Model 401513). Fluorescence data was collected using three samples and three buffer blanks using SYPRO (610 nm ...
-
bioRxiv - Microbiology 2023Quote: ... before being loaded onto a Synergy 2 plate reader (BioTek, Agilent Technologies, Santa Clara, CA) maintained at 37°C ...