Labshake search
Citations for Agilent :
1251 - 1300 of 4268 citations for 6 Iodo 2 methyl 4H 3 1 benzoxazin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed 3 times 10 min in Tris-Triton Solution and mounted on gelatin-coated slides using Fluorescence Mounting Medium (Dako). Z-stack images (4 optical sections ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... was generated by introducing mutations in the 3’ splice site of the pPOLI-WSN-M plasmid using QuikChange II site-directed mutagenesis protocol (Agilent). pPolI-WSN-M-M2SMRtoAAA (Mut1) ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 μl were injected in a splitless mode into an Agilent Gas chromatography mass spectrometry (GC-MS) system (Agilent 7890A chromatograph ...
-
bioRxiv - Plant Biology 2021Quote: ... The Zorbax Eclipse Plus C-18 column Rapid Resolution HT (3 X 100 mm, 1.8 μm, 600 bar, Agilent, USA) was kept at 25°C and the elution was performed with acetonitrile (Optima ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free HSF2BP protein as well as the complex between ARM and F15X were analyzed using a Bio SEC-3 column (Agilent) equilibrated in 25 mM Tris-HCl buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Bisulfite-converted DNA was used for PCR amplification of the DMRs and products were visualized on a 3% Tris-Acetate-EDTA agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Immunology 2021Quote: ... 3×105 CD8+ T cells were plated onto poly-D-lysine coated wells and assayed in XF RPMI medium (Agilent) pH 7.4 supplemented with 10 mM glucose and 2 mM glutamine ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were then washed for 3 min in TBST and incubated for 30 min with HRP (Horse Raddish Peroxidase) conjugated anti-rabbit (Ref: K4003, Dako) or anti-mouse (Ref ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Biochemistry 2022Quote: UPLC separations were performed on a reverse phase Poroshell 120 EC-C18 column (3 × 100 mm, 2.7 μm) (Agilent Technologies) operating at 30 °C and a flow rate of 0.4 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... For signal detection the MACH 3 Mouse HRP Polymer Detection system was employed according to manufacturer’s protocol using DAB+ (Fa.Agilent Technologies, K3468). Slides were counter-stained with Hematoxylin Gill’s Formula (Fa.Vector ...
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...
-
bioRxiv - Neuroscience 2020Quote: ... DI rinse and wash buffer prior to a 3-minute incubation with Haematoxylin ready-to-use solution (K8018, Agilent DAKO) and a further DI rinse and wash step ...
-
bioRxiv - Neuroscience 2020Quote: ... DI rinse and wash buffer prior to a 3-minute incubation with Haematoxylin ready-to-use solution (K8018, Agilent DAKO) and a further DI rinse and wash step ...
-
bioRxiv - Neuroscience 2021Quote: RNA-seq libraries were prepared for each time-points and seady-state sample using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) automated on the NGS WorkStation (Agilent) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Microbiology 2019Quote: All of the mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) [60] ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were de-waxed and antigen retrieval was performed in a pressure cooker at 125°C for 3 min employing an Antigen Retrieval solution (Dako, pH6 for EZH2 ...
-
bioRxiv - Microbiology 2022Quote: ... 50 mg/mL glycogen (1/50 vol/vol and 3 volumes of 100% ethanol. The quality of the isolated RNA was assessed on an Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... 3 μl of the extract were then injected into a GC-QQQ Triple Quad (GC: 7890B, Triple Quad: 7010B, Agilent) with a PAL Autosampler system operating in electron impact ionization mode ...
-
bioRxiv - Cell Biology 2019Quote: ... an EMCCD camera (iXon+ DU 897; Andor), a 3 line (488, 561 and 640nm) monolithic laser combiner with AOTF laser system (Agilent) and Nikon NIS-Elements software ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pVp16-Dest vector for IPTG (isopropyl-β-thiogalactopyranoside)-induced expression (3 h at 37°C) in E.coli strain ArcticExpress (Agilent). After sonication ...
-
bioRxiv - Genomics 2019Quote: ... Blocking was performed by 1h incubation in humid chamber with 3% of normal donkey serum (Vendor) in blocking solution (DAKO). Slides were incubated in humid chamber with primary antibodies overnight at 4°C and washed in PBS 0.2% Triton-X100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then all membranes were washed 3 times and mounted on coverslips using an aqueous fluorescent mounting medium (DakoCytomation, Huddinge, Sweden). Samples were analysed with Leica TCS SP8 confocal microscope (Leica Microsystems ...
-
bioRxiv - Genomics 2019Quote: The FLNC reads from the Isoseq3 refine step were error corrected using Lordec (-k 31 -s 3) with short read RNAseq data from the Universal Human Reference RNA (Agilent) (https://www.ncbi.nlm.nih.gov/sra/SRX1426160 ...
-
bioRxiv - Pathology 2019Quote: ... Chromatographic separation was achieved using a reversed phase column (C18 Zorbax, 50 × 3 mm, 1,7 μm, Agilent, Santa Clara, USA). The analyte was eluted from the column using a gradient with the eluent changing from 5% to 100% methanol in water within 3 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPEC-PTSCX sample cleanup pipette tips and Bond Elut C18/ 3 mL cleanup cartridges were from Agilent (Santa Clara, CA), cell culture slides (8-chamber ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 PCR reactions including two biological replicates and 3 technical replicates per gene were performed using Brilliant SYBR master mix (Agilent), running cycles of 10 minutes at 95°C ...
-
bioRxiv - Molecular Biology 2021Quote: Primary brown adipose cells were isolated and cultured for 3 days before plated in XF cell culture microplates (Seahorse Bioscience). Cells (10,000 cells ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glacial acetic acid was added to dissolve the crystals and the absorbance was measured at 595 nm with a Cytation 3 Image Reader (Agilent). The values of vehicle-treated controls were set to 100%.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).