Labshake search
Citations for Agilent :
1251 - 1300 of 1732 citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Cancer Biology 2024Quote: ... using miR30-adapted sequences (5-6 shRNAs per target) by PCR-cloning a pool of oligonucleotides synthesized on 55k customized arrays (Agilent Technologies) using a well-established system 84–87 ...
-
bioRxiv - Physiology 2024Quote: ... were subjected to quantitative PCR under a temperature profile of 95°C for 3 min followed by 40 cycles for 95°C for 5 sec and 58°C for 15 sec using the Stratagene Mx3000P (Agilent Technologies). For each of the samples ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fluorescence of supernatants was measured at 555/596 nm excitation/emission wavelength (Cytation 5 Multi-Mode Microplate Reader, Agilent, Waldbronn, Germany). 1X alamarBlue reagent solution in ALI medium was used as blank.
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 5 x 15 min in PBST at RT and slides were mounted in DAKO fluorescent mounting medium (Agilent Technologies). EdU staining was performed on sections from larvae that received an EdU pulse ...
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections were washed three times for 5 min each in TBST and mouted with flourescence mounting medium (Dako, Santa Clara, USA). Images of immunofluorescence secitons were captured by confocal microcopy FV1000 (Olympus ...
-
bioRxiv - Biochemistry 2022Quote: ... C238P mutations were introduced step-wise into pDONR221-AR-AD-TAU-5* (bearing L26P, A186P, L192P and C238P mutation and previously described) using a Quickchange™ protocol with Pfu Turbo polymerase (Agilent) and the following primer pairs to generate pDONR221-AR-AD-L56P+Tau-1+Tau-5*:
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the gliadin extracts were injected into a C18 reversed-phase Zorbax 300 StableBond column (4.6×250 mm, 5 μm, 300 Å, Agilent Technologies), maintained at 60°C ...
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the EPP and UPP extracts were separately injected into a Bio SEC-5 column (4.6×300 mm, 500 Å, Agilent Technologies), maintained at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein samples were first desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 mm, 300 µm ID’5mm, Agilent Technologies) for 3 min at a flow rate of 50 ml/min with 100% solvent A and then eluted with 70% solvent B at a flow rate of 50 ml/min for MS detection ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further three times with TBS-T for 5 minutes and stained with DAKO EnVision-HRP rabbit/mouse (Agilent; #K5007) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was additionally purified with ZymoResearch DNA Clean & Concentrator-5 columns (D4003T) and digested DNA profiles confirmed using the 2100 Bioanalyzer with the Agilent DNA High Sensitivity chip (Agilent Technologies). The libraries were then prepared using the Qiaseq Ultra Low Input Library Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Chromatography was carried out using a Zorbax SB C18 column (150 × 2.1 mm, 5 µm, Zorbax, Agilent, Santa Clara, CA, USA) which was proceeded with a SB-C18 Guard Cartridges (12.5 × 2.1 mm ...
-
bioRxiv - Microbiology 2023Quote: ... muropeptide originating from peptidoglycan extracted from the same number of cells (1.5×109) were analyzed by reverse phase-ultra high-pressure liquid chromatography (RP-UHPLC) using a 1290 chromatography system (Agilent Technologies) equipped with a Zorbax Eclipse Plus C18 RRHD column (100×2.1 mm ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Cancer Biology 2024Quote: Adherent cell growth assays were performed via label free live cell imaging using the Cytation 5 Imaging Multi-Mode reader with attached BioSpa (Agilent BioTek). For 72 hr growth analysis cells were plated at ∼500 cells/well while for 144 hr growth analysis cells were plated at ∼100 cells/well ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed using a QuantStudio™ 5 Real-Time PCR System with Brilliant II low ROX Sybr Green (Agilent). Reactions were performed with at least 2 technical replicates and 3 biological replicates were performed for each experiment ...
-
bioRxiv - Cell Biology 2024Quote: ... Following the 24 min gradient the analytical column was backflushed for 6 min with 99% acetonitrile at a 0.8 ml/min flow rate followed by a 5 min re-equilibration step (MassHunter Metabolomics dMRM Database and Method, Agilent Technologies). Data analysis was performed with MassHunter Quantitative Analysis (v ...
-
bioRxiv - Biophysics 2024Quote: ... The plate was gently shaken to mix the well contents and the absorbance at 595nm was measured with a Biotek Cytation 5 Microplate Reader (Agilent, USA). The absorbances of the diluted samples were used to form dilution curves and the slopes of the linear regions of each curve were compared to determine the necessary dilution factors for each lysate that would allow the curves to overlap ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Bioengineering 2024Quote: ... The pellets from centrifugation were dried under vacuum and re-dissolved using 5% acetic acid aqueous solution for purification by HPLC (1260 Infinity, Agilent Technologies) equipped with a C8 column (Zorbax 300SB-C8 ...
-
bioRxiv - Biochemistry 2024Quote: ... Tryptic peptides were separated with a microfluidic reversed-phase HPLC chip (ZORBAX 300SB-C18; particle size, 5 μm; inner diameter, 75 μm; and length, 43 mm; Agilent Technologies). Samples were loaded using 0.1% formic acid and 5% acetonitrile in water as a mobile phase at flow rate of 4 μl/min ...
-
bioRxiv - Plant Biology 2024Quote: ... according to the manufacturer’s instructions with the following changes: RNA was fragmented 5’ and the protocols were automated using an Agilent NGS workstation (Agilent Technologies) with purification steps described by Lundin et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The excised fragment was introduced in the MCS 2 (EcoRI/NotI) of the yeast expression vector pESC-URA (Stratagene), cloned in the E ...
-
bioRxiv - Bioengineering 2022Quote: ... SARS-CoV-2 RBD mutant plasmids were generated by Quikchange site-directed mutagenesis according to manufacturer’s instructions (Agilent, 210513). Biotinylated proteins were made by co-transfecting Avitagged RBD plasmids with a BirA expression plasmid and into Expi293 cells using FectoPRO ...
-
bioRxiv - Microbiology 2019Quote: ... Immunolabelling was performed as follows: grids were placed directly on drops of 2% normal goat serum (DAKO, Glostrup, Denmark) in 0.1 M phosphate buffer to block non-specific binding then incubated with the primary antibodies ...
-
bioRxiv - Plant Biology 2021Quote: ... Each sample set was run together with the external standard (2-AA labeled dextran ladder, Glyko Prozyme, Hayward, CA). In each chromatogram 15 individual peaks were identified and peak assignments were made basing on glucose units (GU) ...
-
bioRxiv - Bioengineering 2021Quote: ... samples were subjected to a treatment with 0.3% Sudan black solution for 10 min prior to blocking for 2 h (Dako Blocking Solution X0909 ...
-
bioRxiv - Genetics 2020Quote: ... Step 1.3 of the protocol was performed with the following modifications: Step 1.3.q slides were incubated in Dako bluing buffer (#CS70230-2 Agilent) for 30 s ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS and 10% Methanol for 10 min and incubated overnight with the primary antibody (Table 2) in PBS/T 0.1 with 10 % normal swine/ goat or rabbit serum (Dako). Second ...
-
bioRxiv - Cell Biology 2021Quote: ... Single cells were separated using a 100 μm strainer and labelled with CD31 antibody (1:200, M082329-2, DAKO) at 4°C for 45 min followed by 30 min staining with a goat anti-mouse secondary antibody conjugated to AlexaFluor 488 or 555 (1:400 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 x 104 cells were seeded into each well of a V3 96-well plate (Agilent, Cat. # 101085-004) and cultured 24 h before measuring OCR ...
-
bioRxiv - Cell Biology 2020Quote: ... smNPCs were split with accutase and 2×105 cells per well were seeded on Seahorse cell culture microplates (Agilent) one day before the ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was supplemented with 2 mM CaCl2 and applied to 2.4 mL bed volume (BV) Calmodulin-affinity resin (Agilent) pre-equilibrated in ORC lysis buffer containing 2 mM CaCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... deparaffinized sections were subjected to antigen retrieval and processed with the EnVision+ HRP kit (K401111–2, DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2% BSA (PAA Laboratories GmbH, Germany) and 1:50 dilution of normal goat serum (Dako Denmark A/S, Denmark). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... and (2) the use of an Agilent split/splitless injector with a splitless gooseneck liner with glass wool (Agilent). 350 μL of the reconstituted extract was dried in 400 μL inserts in 1.5 mL chromatography vials after the addition of 40 μL ethoxyamine hydrochloride in pyridine (c = 20 g L-1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enzyme was heat inactivated at 75°C for 2 minutes and then removed with 1μl of Strataclean resin (Agilent). Capped RNAs were precipitated using 2M ammonium acetate and isopropanol to remove any residual nucleotides ...
-
bioRxiv - Biochemistry 2019Quote: ... All final extracts were dried under vacuum (Extractor Plus®, Agilent; settings: 30°C, 2 h, 1000 rpm, VAQ).