Labshake search
Citations for Agilent :
1201 - 1250 of 3452 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... mouse anti-HIV-1 P24 (Dako), goat anti-human TRAIL (RyD Systems ...
-
bioRxiv - Neuroscience 2024Quote: ... antiGFAP (rabbit, 1:500, Dako, USA), antiOCT4 (rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100 (DAKO; 1:600), mouse anti-Myelin Basic Protein (Covance SMI 94 ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP (Dako, Denmark; 1:500) proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Myogenin (diluted 1/100, DAKO), anti-MYH3 (diluted 1/100 ...
-
bioRxiv - Physiology 2023Quote: ... anti-CD45 (Dako M0701; 1:100) or anti-SLC2A1 (Abcam ab15309 ...
-
bioRxiv - Immunology 2024Quote: ... anti-IgD (1:2000; AA093; DAKO), anti-CD27 (1:1000 ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced through site-directed mutagenesis (QuikChange II XL, with 10 XL Gold cells; Agilent Technologies, Kista, Sweden) and confirmed by sequencing at the Linköping University Core Facility.
-
bioRxiv - Microbiology 2021Quote: Vortexed 10 kDa-filtered plasma samples (about 135 µL) were transferred in a 0.5 mL 96-well plate (Agilent) and mixed on thermoshaker Eppendorf (1.5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 μl of each protein sample at 8.5-10 mg/ml was injected onto a BioSEC3-300 column (Agilent) at a 0.2 ml/min flow rate ...
-
bioRxiv - Neuroscience 2021Quote: ... Deparaffinized sections and free-floating brain slices were incubated for 10-30 min in Target Retrieval Solution (S1700; Dako) at 72-102 °C in a water-bath for antigen retrieval20 ...
-
bioRxiv - Bioengineering 2021Quote: ... samples were subjected to a treatment with 0.3% Sudan black solution for 10 min prior to blocking for 2 h (Dako Blocking Solution X0909 ...
-
bioRxiv - Cell Biology 2021Quote: ... FACS sorted MPs were plated on XF96 cell culture microplates coated with 10% Matrigel in warm assay medium (Agilent), the cell culture plate was centrifuged with 200 g for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS and 10% Methanol for 10 min and incubated overnight with the primary antibody (Table 2) in PBS/T 0.1 with 10 % normal swine/ goat or rabbit serum (Dako). Second ...
-
bioRxiv - Molecular Biology 2021Quote: ... In TTBS rinsed slides were blocked for 10 min at room temperature using DAKO peroxidase blocking solution (#S200230, Dako), washed again in TTBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The desalted large peptide mixture was separated by a home-packed PLRP column (PLRP-S, 200 mm length x 500 μm i.d., 10 μm particle size, 1,000 Å pore size, Agilent) in a 63-min gradient from 10% to 90% mobile phase B (mobile phase A ...
-
bioRxiv - Bioengineering 2020Quote: ... VO2max = 1.04×10−16 mol/s/cell was measured for hiPSC-Heps using the Seahorse XF24 cellular respirometer (Agilent) (see ...
-
bioRxiv - Immunology 2021Quote: ... for 10 minutes at 37°C for F4/80 or blocked with a protein block (catalog number x0909, Dako) for 10 minutes followed by an Fc block (catalog number 553142 ...
-
bioRxiv - Biochemistry 2022Quote: ... The gas chromatograph was equipped with a DB-5 ms column (30 m × 0.25 mm, film thickness 0.25 μm; including 10 m DuraGuard column, Agilent Technologies) and a GC inlet liner (ultra inert ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were washed with PBS 1X for 10 mins and coverslipped with Dako fluorescence mounting medium (Dako North America).
-
bioRxiv - Evolutionary Biology 2022Quote: ... and equipped with a VF-5ms column (30 m × 0.25 mm × 0.25 μm, with 10 m EZ-guard column, J&W Agilent Technologies). For the analysis of CHCs ...
-
bioRxiv - Cell Biology 2019Quote: ... then permeabilized with PBS 0.25% triton X-100 for 10 minutes and blocked by a 20 minute incubation in DAKO block (Agilent). BrdU was detected by incubation with anti-BrdU (ICR1 ...
-
bioRxiv - Genomics 2020Quote: ... The coverslips were incubated with 10 μL mixture of a custom probe set targeting a selected DNA locus (Agilent) and SureFISH Hybridization Buffer (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... N≥50 worms (10 worms/ well) were transferred to the Seahorse XF96 Cell Culture Microplate (Agilent Technologies, 101085-004) in a total volume of 180 uL ...
-
bioRxiv - Neuroscience 2019Quote: Fractions were reconstituted in 10% FA and analyzed in two technical replicates with a UHPLC 1290 system (Agilent technologies) coupled to an Orbitrap Q Exactive X mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: A serum volume of 10 µL was diluted ten times with load/wash buffer solution (Agilent Cat.#: 5185-5987). Each sample was filtered through a 0.22-μm spin filter (Agilent Cat.# ...
-
bioRxiv - Microbiology 2022Quote: ... We then amplified 3 µL of cDNA (10 ng/µL) in Power SYBR (Thermo) with 1.6 µM primers using the AriaMx real-time PCR system (Agilent) in a volume of 12 µL ...
-
bioRxiv - Microbiology 2022Quote: ... contained a fused-silica fibre of 80μm x 10 mm coated with a layer of divinylbenzene–carboxen–polydimethylsiloxane (DVB/CWR/PDMS) (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the assay medium was prepared by supplementing Seahorse XF Base medium (pH 7.4) with a specific combination of 10 mM glucose (100X stock, Agilent), 1 mM pyruvate (100X stock ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The protein (10 μL) was loaded by an LC system (Agilent 1290 Infinity II, Agilent Technologies, Santa Clara, CA) on a HPLC column (PLRP-S 1000 Å ...
-
bioRxiv - Physiology 2023Quote: ... Secreted protein in cell culture media was enriched using StrataClean Resin (Agilent, 10 µl per 5 ml of media) as previously described11,24.
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent] ...
-
bioRxiv - Neuroscience 2024Quote: The fatty acid profile and content in 10 mg of each fecal sample were determined by gas chromatography (Agilent Technologies 6890 N Series Gas Chromatograph ...
-
bioRxiv - Cell Biology 2024Quote: ... the buffer was exchanged into basic PBS (pH 8.0) with 0.1 % Tween-20 for a 2 h conjugation with 10 µM streptavidin (Prozyme, SA10) and 10 µM fluorescent dye (Lissamine Rhodamine B ethylenediamine ...
-
bioRxiv - Biochemistry 2024Quote: ... linear gradient from H2O/MeCN + 0.1 trifluoracetic acid from 10 to 90% over 60 min) on a 1260 Infinity II LC System (Agilent). Peaks were collected manually according to the peak height at 480 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... The CDKN1B Serine 10 to alanine mutant reporter was cloned using the Quikchange II site-directed mutagenesis kit (Agilent).
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Biochemistry 2024Quote: ... ab109401 (1:5000)) or and anti-total Tau antibody (rabbit anti-human Tau, Dako, #A0024 (1:5,000)) diluted in 3% BSA in PBS-T overnight at 4°C shaking ...
-
bioRxiv - Plant Biology 2020Quote: ... and 10 µl samples injected into an Agilent Technologies 6420 Triple Quad Liquid Chromatography-Tandem Mass Spectrometry instrument (Agilent, USA). A Zorbax Extend-C18 column 3.0×150mm (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were isolated from 10% non-denaturing gels by size selection and their quality and quantity measure by DNA high sensitivity chips (Agilent) with Bioanalyzer and Qubit.
-
bioRxiv - Molecular Biology 2021Quote: ... Forty reaction cycles of 10 s at 95 and 30 s at 58 °C were carried out on a Multiplex 3005 Plus (Stratagene/Agilent). The amplicon coordinates relative to the 47S rRNA initiation site (BK000964v3 ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were resuspended in 10% formic acid (FA)/5% DMSO and analyzed with an Agilent 1290 Infinity (Agilent Technologies, CA) LC ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...