Labshake search
Citations for Agilent :
1201 - 1250 of 1944 citations for 7 Chloro 3 4 dihydro 1H quinoxalin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... heat mediated antigen retrieval was performed for 3 min at 125°C in citrate pH 6.0 target retrieval solution (Dako Cat# S2369) using a decloaking chamber (Biocare Medical) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were read at 450 nm and 560 nm wavelengths using a BioTek Cytation 3 Cell Imaging Multi-Mode Microplate Reader (Agilent Technologies). Plasma samples isolated from retroorbital bleeds were used for ProcartaPlex immunoassays (Thermo Fisher ...
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were loaded into pre-conditioned Phenomenex Strata XL-100 60 mg/3 ml cartridges (Torrance, CA) and passed through it using positive pressure manifold (Agilent Technologies). Flow through was collected subsequently and 100 µL of filtrate was mixed with 100 µL of water for the LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: ... such as the uncut PT oligos and the four 3-mer release oligos (CCA, CCC, CCG, and CCT) using an HPLC system (Agilent 1290) as outlined below ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein lysates were incubated at 4°C with a mouse monoclonal antibody directed against the FLAG-tag (M2, Stratagene). Immunocomplexes were pulled down by incubation with protein G sepharose ...
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting 40 samples were diluted 4:1 with Buffer A for Multiple Affinity Removal LC Columns (Agilent Technologies), filtered through a 0.22 μm hydrophilic PVDF membrane filter plate (Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% BSA and 0.4% triton X-100) followed by incubation overnight at 4°C with 1:500 rabbit anti-C3 antibody (Dako) and 1:10,000 guinea pig anti-vGluT2 (Synaptic Systems ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the cells were washed twice with 200 μL/well of assay medium (XF DMEM Base Medium, pH 7.4 containing 25 mM Glucose and 4 mM Glutamine; Agilent). After washing ...
-
bioRxiv - Physiology 2021Quote: ... Samples were incubated overnight at 4°C in primary antibodies targeting anti-insulin (1:200, Abcam #Ab7872, Dako #A0564), anti-glucagon (1:100 ...
-
bioRxiv - Plant Biology 2021Quote: ... A total of 4 µL of each filtered sample was loaded onto a C18 high-capacity nanoLCchip (Agilent Technologies) using a 1200 series capillary pump (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene expression analysis was conducted using Agilent Whole Mouse Genome 4×44 multiplex format oligo arrays (Agilent Technologies 014868) following the Agilent 1-color microarray-based gene expression analysis protocol ...
-
bioRxiv - Pathology 2022Quote: ... DNA microarray analysis was performed using a Quick Amp labeling kit and a Whole Human Genome DNA Microarray 4×44K according to the manufacturer’s protocol (Agilent). Signal intensity was normalized by adjusting the data to a 75th percentile value ...
-
bioRxiv - Neuroscience 2021Quote: iNeurons were replated on DIV 4 onto polyornithine/laminin coated in the Seahorse XF96 Cell Culture Microplate (Agilent Technologies) at a density of 50 000/well ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The spinal cord tissue was dissected and packed into a 4 mm zirconium rotor (Agilent Techonology Inc., CA, USA) with 50 μL of D2O saline (0.9% ...
-
bioRxiv - Microbiology 2021Quote: ... and Tyr 254 in TlpALBD were generated via site-directed mutagenesis of pBH4_TlpALBD with primers listed in Supplemental Table 4 (QuikChange, Stratagene). TlpALBD and all point mutants were purified as described by Sweeney et al ...
-
bioRxiv - Physiology 2024Quote: ... Sections were fixed with 0.2% glutaraldehyde + 4% PFA and mounted with Glycergel Mounting Medium (Agilent Technologies, Santa Clara, CA). The antisense probe generated with T7 polymerase showed the specific signal ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated overnight at 4°C with primary antibodies in DAKO REALTM Anti-body diluent (Agilent, Cat#S2022). Secondary antibodies (1:500 dilution ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 technical replicates for each time point were analysed using Microwave Plasma - Atomic Emission Spectrometry (MP-AES 4210, Agilent) as reported previously24.
-
bioRxiv - Neuroscience 2023Quote: ... and C21 was accomplished using a C18 Security guard cartridge (4.6 × 4 mm) and Zorbax Extend-C18 column (4.6 × 75 mm, 3.5 μm, Agilent 766953-902) at 40 °C (mobile phase A = H2O + 0.1% formic acid ...
-
bioRxiv - Cancer Biology 2021Quote: ... for which tissues was treated with heated Target Retrieval Solution pH 6.1 (S169984-2, Dako) for 30 min) ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue sections −1.70 mm from Bregma were mounted onto microscope slides (Dako, Cat# K802021-2), allowed to dry upright for 30 min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Labeled DNA was hybridized to a custom ChIP-on-Chip 2×105K microarray (Agilent G4498A), designed with 102,839 60-nucleotide probes tiled across the K ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antigen retrieval was performed by boiling slides immersed in Target Retrieval Solution (DAKO, S169984-2) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...