Labshake search
Citations for Agilent :
1201 - 1250 of 1499 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were split with EDTA and 5×104 cells per well were seeded on Seahorse XF24 cell culture microplates (Agilent) 24 h before the experiment ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5% serum) before analysis of OCR and ECAR in a Metabolic Flux Analyzer (Seahorse Bioscience, North Billerica, MA 96XP).
-
bioRxiv - Cell Biology 2022Quote: ... Non-specific antibody binding was blocked by incubation for 30 min with blocking solution containing 5% normal goat serum (NGS, Dako) at room temperature followed by overnight incubation at 4 °C with different primary antibodies listed in Table 1 ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Cell Biology 2022Quote: ... three 5 μm-thick tissue sections separated by 300 μm were stained with guinea pig anti-insulin antibody (undiluted, Dako IR002 ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 μl was used for a 10 μl qPCR reaction with 5 μl THUNDERBIRD SYBR Green mix (Toyobo) on an Mx3000P qPCR System (Agilent) using the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality of final single cell 5’ GEX libraries was assessed by Qubit quantification and fragment analysis (DNF-474 High Sensitivity NGS Fragment Analyzer Kit, Agilent). The sequencing was performed on a NextSeq500 device (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 384-well plates on 5 μL scale reactions using 2 μL diluted cDNAs and Brilliant III Ultra-fast SYBR Green qPCR Master Mix (Agilent) with primers listed in Table S7 at a final concentration of 0.4 μM ...
-
bioRxiv - Genomics 2021Quote: ... Between 1 and 5 ng of the purified digested DNA was loaded on a High Sensitivity DNA chip (Agilent Technologies) and run on an Agilent 2100 Bioanalyzer System ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The system was equipped with a 30 m x 0.32 mm x 0.25 μm fused silica capillary column (HP-5, Agilent Technologies, Germany). High purity (99.999% ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 μL was loaded on to a reversed-phase column (Agilent Zorbax SB C8, 150 x 2.1 mm, 3.5 μM) through an Agilent 1260 HPLC system for the separation of various venom components ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1µg of Hi-C library per sample was mixed with 5 μl of SureSelect XT HS and XT Low Input Blocker Mix (Agilent). Samples were denatured at 95°C for 5 minutes and pre-hybridized for 10 minutes at 65°C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: To calculate LOD and LOQ of phthalates we used the standard deviation of the first point of the curve that had a signal-to-noise ratio SNR>5 given by Agilent Mass Hunter Qualitative Analysis B.06.00 that calculates the distance from the height of the peak to the midline between the maximum and minimum noise at baseline ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant (5 μL) was injected into the Agilent 7890 gas chromatograph equipped with an electron capture detector (Agilent, USA), which was used to determine the short-chain fatty acids of A ...
-
bioRxiv - Immunology 2020Quote: ... These genes were cloned into an Adenovirus type 5 replication-defective E1/E3 deleted vector using the Ad-Easy Adenoviral Vector System (Agilent). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutagenesis of the A2REs in the Ins1 5’-UTR was performed with the QuikChange II Site-directed mutagenesis kit (Agilent). Cells were co-transfected with each pNL1.1 construct and the pGL4.54 for normalization ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Systems Biology 2023Quote: ... we used an Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 µm particle size, Agilent Technologies) and a Diode Array Detector (G4212 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... GC/MS analysis was performed on a Trace GC Ultra gas chromatograph with AS3000 Autosampler equipped with a Zorborbax DB-5 column (30 m, 0.25 mm i.d., 0.20 μm film thickness; Agilent J&W Scientific), with the eluate transferred at 280 °C to a Polaris Q mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of the protein extracts were run through a home-packed PLRP-S capillary column (200 mm long, 0.25 mm i.d., 5 μm particle size, 1000 Å pore size; Agilent Technology). The column was heated to 60 °C at an 8 μL/min flow rate ...
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were centrifuged (20,000 x g for 10 min) and desalted using 5 uL C18 cartridges on the AssayMap BRAVO platform (Agilent Technologies). For each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then transferred immediately into a 5 mm NMR tube (Wilmad) and placed into a 600 MHz magnet with a coldprobe (Agilent). The peptide backbone was assigned using a combination of BEST versions of 3D HNCA ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2022Quote: ... 23S and 16S rRNA are separately isolated to purity from the large RNA fraction following HPLC using the Bio SEC-5 column (Agilent; 7.8 mm ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2023Quote: ... the peptides were reconstituted in 10 mM TEAB and fractionated using a bRPLC column (Agilent 300 Extend-C18 column, 5 µm, 4.6 mm × 250 mm, Agilent Technologies) under an increasing gradient of the mobile phases consisting of 10 mM TEAB in water and 90% acetonitrile (ACN) ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Membrane fluidity was determined by using an excitation wavelength of 350 nm and measuring fluorescence at 460 nm and 500 nm emission wavelengths on a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The generalised polarisation (GP ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Bioengineering 2023Quote: ... Peptides were loaded to a nanoscale HPLC column composed of 10 cm of Polaris C18 5 μm packing material (Agilent), followed by 4 cm of Partisphere 5 SCX (Whatman) ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed in PBS and incubated in DAPI (1:500) for 5 min before mounting with the immunofluorescence mounting media (DAKO).
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...