Labshake search
Citations for Agilent :
1101 - 1150 of 8310 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated with the required primary antibody (ABri: 338 1:1000 from Ghiso lab; ADan: 5282 1:1000 from Ghiso lab; CD68: 1:150 DAKO; CR3/43: 1:100 DAKO) for 1 hour at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: The LbCas12a library targeting the protein coding genes in PO1f were ordered as an oligonucleotide pool from Agilent Technologies Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... The assay was normalized with protein and analyzed with the XFe 2.0.0 software (Agilent Technologies Inc. CA, USA).
-
bioRxiv - Immunology 2021Quote: Biotinylated proteins were isolated from the organ homogenates using a Bravo AssayMap platform and AssayMap streptavidin cartridges (Agilent). The cartridges were equilibrated with ammonium bicarbonate (50mM ...
-
bioRxiv - Neuroscience 2020Quote: ... proteins were desalted online by reversed-phase chromatography on a Poroshell 300SB C3 column (1.0×75mm, 5um, Agilent Technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... Sections were then incubated for 40 mins in 3% H2O2 TBST solution and blocked with protein block (Dako) for 20 mins ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies used for immunofluorescence on brain sections were polyclonal rabbit anti-glial fibrillary acidic protein (GFAP; DAKO, Santa Clara ...
-
bioRxiv - Biochemistry 2020Quote: Affinity depletion of abundant serum proteins was carried out on a HP1290 HPLC system (Agilent, Santa Clara, CA) using the Multiple Affinity Removal Column Human 14 (MARS 14 ...
-
bioRxiv - Neuroscience 2020Quote: ... Slides were washed 3X 5 mins with 1X PBS and blocked in DAKO protein-free serum block (DAKO) overnight in a humidified chamber at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... the proteins were purified via reversed phase HPLC using a ZORBAX Eclipse Plus C18 (3.5 μm) column (Agilent) equilibrated with 0.1% trifluoroacetic acid (TFA) ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 15 min (Dako, X0909). Primary Axl antibody (RnD Systems ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 8 min (Dako, X0909). Primary CD133 antibody (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2020Quote: ... All antibody conjugates were run on a Bioanalyzer Protein 230 electrophoresis chip (Agilent Technologies, cat. no. 5067-1517) to verify successful conjugation.
-
bioRxiv - Microbiology 2020Quote: ... The peptides from proteins digested were desalted and concentrated with C18 reverse phase chromatography (OMIX C18, Agilent technologies) and peptides were eluted with 80% acetonitrile (ACN ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 μl of a protein sample at 8.5-10 mg/ml was injected to a BioSEC3-300 (Agilent) or Superdex 75 10/300 GL increase column (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... To generate mutant proteins these vectors were altered by using QuickChange® XL site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were expressed in and purified from BL21-CodonPlus(DE3)pLysS Escherichia coli (Agilent Technologies, Santa Clara, CA) as described 48 and dialyzed against PLS buffer ...
-
bioRxiv - Cell Biology 2021Quote: All recombinant proteins were expressed in either BL21-CodonPlus (DE3)-RIPL or ArcticExpress (DE3) competent cells (Agilent Technologies) grown in LB medium overnight at 13-16°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 14,000 rpm on a tabletop centrifuge to remove aggregated proteins and then sequentially injected into a HPLC (Agilent) equipped with a C18 analytical column (Agilent Poroshell 120).
-
bioRxiv - Biophysics 2022Quote: ... The UV–visible spectra of purified NQO1 proteins were measured in a Cary spectrophotometer (Agilent Technologies, Waldbronn, Germany) and used to quantify NQO1 concentration and the content of FAD as described in (12) ...
-
bioRxiv - Synthetic Biology 2022Quote: The Cas12a library targeting the protein-coding genes in PO1f was ordered as an oligonucleotide pool from Agilent Technologies Inc ...
-
bioRxiv - Immunology 2022Quote: ... C antibody (clone W6/32) that was immobilized and covalently linked to Protein A cartridges (Agilent G5496-60000). Peptides were acid eluted from antibody bound ProteinA cartridges using 0.1M acetic acid/0.1%TFA followed by desalting with C18 solid-phase extraction (SPE) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a rinse with TBS and a 30-minute blocking step with the Dako Protein Block (Dako) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: Free-floating brain tissue was stained for polyclonal rabbit anti-glial fibrillary acidic protein primary antibody (GFAP; DAKO, Santa Clara ...
-
bioRxiv - Bioengineering 2023Quote: ... cryosections of the tissues were first permeabilized and blocked using a protein block solution (Dako, Carpinteria, CA, USA) containing 0.1% saponin (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins (GST, GST-BZR1, GST-PIF3 and GST-H2A) expressed in BL21- CodonPlus (DE3)-RIL (Agilent Technologies) were purified using glutathione beads ...
-
bioRxiv - Biochemistry 2023Quote: ... All GFP-OGG1 proteins were expressed in BL21-CodonPlus (DE3)-RP Escherichia coli (E. coli) competent cells (Agilent). The cells were grown at 37 °C to an OD600-0.6 and OGG1 expression was induced with 0.5 mM isopropyl-b-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Immunology 2023Quote: SECMALS analysis of protein nanoparticles was performed on a 1260 Infinity II high-performance liquid chromatography system (Agilent) coupled with a miniDAWN and Optilab detectors (Wyatt Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were passively cooled to room temperature and then incubated in Protein Block Serum-Free Reagent (Agilent (Dako), Santa Clara ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were passively cooled to room temperature and then incubated in Protein Block Serum-Free Reagent (Agilent (Dako), Santa Clara ...
-
bioRxiv - Molecular Biology 2024Quote: The purified IMP2 protein +/− RNA was analyzed by SEC-MALS using an HPLC system (Agilent Technologies 1260 Infinity) connected to a MALS system (Wyatt DAWN HELEOS II Ambient with Optilab TrEX HC differential refractive index detector) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Genomics 2019Quote: ... WES libraries were prepared using the SeqCap EZ Exome Kit v3 (NimbleGen) or the SureSelect Human All Exon V7 Low Input Exome kit (Agilent). Equimolar pooled libraries were sequenced on HiSeq 2000 and 4000 instruments (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Genomics 2019Quote: All libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and checked for fragment size using the TapeStation D1000 kit (Agilent). The libraries were pooled in equimolar concentration for a total pooled concentration of 2nM ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using Illumina NovaSeq flowcell with 100 bp single-end runs.
-
bioRxiv - Neuroscience 2022Quote: ... cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen) and a qPCR add-on kit after which they were run on a Fragment Analyzer (Agilent), equimolar pooled and sequenced using an Illumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...