Labshake search
Citations for Agilent :
1051 - 1100 of 2440 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Escherichia coli BL21 (DE3) RP competent cells (Stratagene) were transformed with pET15b[relMtb] ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated with 10 μM FCCP (Agilent) for 2 h before cell lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21 DE3 RIL (codon plus) cells (Stratagene). All cDNA plasmids (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... Ligation products were transformed into XL10 cells (Agilent). Colonies containing recombinant genomes were isolated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Seahorse Cell Mito Stress Test Kit (Agilent Technologies) was used to measure mitochondrial OxPHOS ...
-
bioRxiv - Biophysics 2021Quote: ... coli BL21 (DE3)-gold competent cells (Agilent Technologies) transformed with the pT7-7 plasmid encoding α-synuclein ...
-
bioRxiv - Immunology 2022Quote: ... For the XF Cell Mito Stress Test (Agilent), the cell medium was replaced with XF RPMI base medium containing 10 mM glucose ...
-
bioRxiv - Cell Biology 2022Quote: ... using the Cell MitoStress Test Kit (Seahorse Bioscience), according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and cytokeratin (tumor cells, AE1/AE3, Agilent Technologies). The entire TMA core was imaged using the 20x objective on the Vectra 3.0 microscope (Akoya Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: AD-293 (HEK) cells were purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Physiology 2020Quote: ... Positive cells were labeled by DAB chromogen (DAKO) for 5 minutes ...
-
bioRxiv - Immunology 2020Quote: ... Seahorse XF Cell Mito Stress Test (Agilent Technologies) was used following manufacturer’s indications ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21 DE3 RIL (codon plus) cells (Stratagene). All cDNA plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were mounted in mounting medium (DAKO, S3023). 3D stacks of confocal images were acquired with 60X NA1.3 water lens on a Nikon Eclipse Ti Microscope equipped with Yokogawa CSU-X1 spinning disc unit ...
-
bioRxiv - Cell Biology 2021Quote: ... A Moflo high-speed cell sorter (Dako Cytomation) was used ...
-
bioRxiv - Cell Biology 2021Quote: ... coli BL21(DE3) competent cells from Agilent (200131) or Thermo Scientific (EC0114) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were sequentially treated with 1μM oligomycin (Agilent), 1μM FCCP (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... BL21dLacGold cells (Didovyk et al., 2017) (Agilent, 230132), or the CRISPR+ ...
-
bioRxiv - Biophysics 2020Quote: ... coli and purified from BL21-CodonPlus cells (Agilent) as described previously (14) ...
-
bioRxiv - Cancer Biology 2022Quote: After coating Seahorse XFe24 Cell Culture Microplates (Agilent) with Poly-D-lysine hydrobromide (FUJIFILM Wako Pure Chemical) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were mounted in Fluorescent Mounting Medium (DakoCytomation) supplemented with Hoechst 33342 ...
-
bioRxiv - Biophysics 2022Quote: ... coli BL21(DE3) Codon Plus RIL cells (Agilent) as described previously with minor modifications (119) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli BL21(DE3)-RIL CodonPlus cells (Agilent Technologies) and grown in LB media containing appropriate antibiotics ...
-
bioRxiv - Biophysics 2022Quote: ... coli B21-CodonPlus (DE3)-RIPL competent cells (Agilent). MSP1D1 contains a N-terminal 6xHis tag that can be removed by TEV protease ...
-
bioRxiv - Biophysics 2023Quote: ... coli BL21 (DE3)-gold cells (Agilent Technologies, USA), as described 52 ...
-
bioRxiv - Biochemistry 2023Quote: ... E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 DE3 RIL (codon plus) cells (Stratagene). All cDNA plasmids ...
-
bioRxiv - Biochemistry 2023Quote: ... prior to transformation into DH5ɑ competent cells (Agilent). Successful mutation of isolated clones was verified by Sanger sequencing and clones were retransformed into BL21-CodonPlus (DE3)-RP competent cells (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: The Seahorse XF Cell Mito Stress Test (Agilent) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Cell proliferation was measured on xCELLigence® (Agilent) E-Plate VIEW (96 wells ...
-
bioRxiv - Cell Biology 2023Quote: ... chemically competent BL21-CodonPlus (De3) cells (Agilent Technologies) were transformed with the respective pET-28 vector via 42°C heat shock and plated overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) were used ...
-
bioRxiv - Biophysics 2023Quote: ... was transformed into Escherichia coli BL21 cells (Agilent). Cells were grown and protein expression was induced by the addition of 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with 100 µg/mL of ampicillin (amp100 ...
-
bioRxiv - Bioengineering 2023Quote: ... Coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Seahorse XF96 Cell Culture Microplates (101085; Agilent Technologies) were treated with Cell-Tak Cell and Tissue Adhesive (354240 ...
-
bioRxiv - Genetics 2023Quote: ... coli Arctic Express (DE3) cells (Agilent Technologies Inc.) transformed with the mouse RNF212B-6xHis expression vector were grown in 2L of LB at 30°C to an OD600 of 0.8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed once with Rinse solution (Dako) at room temperature for 10 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... and transformed into XL10 Gold competent cells (Agilent). Bsp11-407 was amplified using primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgccgtttcttcaggttattcc ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were mounted with fluorescence mounting medium (DAKO). Images were captured by a Zeiss Axio Imager Z1.
-
bioRxiv - Cell Biology 2024Quote: AD293 cells (Cat # 240085, Agilent, Santa Clara, USA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2024Quote: ... BL21-CodonPlus (DE3)-RIPL competent cells (Agilent, 230280) are transformed with sequence-validated vectors ...
-
bioRxiv - Immunology 2024Quote: ... a Seahorse cell culture 96 well-plate (Agilent) was coated with 50μL/well of 50 μg/mL Gibco Poly-D-lysine (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Unbound antibody was removed with washing buffer and the fraction of cells with surface protein labeled with CD44 antibody was determined using a MoFlo cell sorter (Dako Cytomation).
-
bioRxiv - Cell Biology 2019Quote: We assessed the respiratory capacity of NPKO and control cells using the Cell Mito Stress Test Kit (Agilent Cat. #103010-100) on the Agilent Seahorse XFp instrument ...
-
bioRxiv - Cell Biology 2021Quote: ... MSCs were seeded at a density of 10,000 cells/well in a XF96 cell culture 96-well microplate (Agilent 101085-004) precoated with 10 µg/ml of fibronectin (Sigma F1141) ...
-
bioRxiv - Immunology 2021Quote: ... SC-macrophages or SC-macrophages treated with 10 nM RvD1 as above were seeded (30,000 cells/well) on a Seahorse XF96 cell culture plate (Agilent, #102601-100). The cells were incubated in glucose-free ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa and MDA-MB-231 cells were plated accordingly as low (50% confluency) and high (100% confluency) density cultures in 24 well cell plates (Seahorse bioscience) in DMEM growth medium containing 10% FBS and placed in a 5% CO2 incubator ...
-
bioRxiv - Neuroscience 2020Quote: ... HAP1 (40,000 cells/well) and DU145/Rho0 (30,000 cells/well) were plated on Agilent Seahorse XF96 V3-PS Microplates (Agilent 101085-004) approximately 24 hours before stress tests ...