Labshake search
Citations for Agilent :
1051 - 1100 of 4080 citations for 1 4 Bis acetyloxy 3 dodecylsulfanyl 2 naphthyl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Neuroscience 2024Quote: ... blots were washed 3 times during 10 min with PBS-T and incubated with horseradish peroxidase-conjugated secondary antibody (Dako) for 1 h and washed again 3 times ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Microbiology 2024Quote: ... These pellets were lysed and 3 µl samples were analyzed using Agilent InfinityLab Poroshell 120 HILIC-Z (Agilent 683775-924). The chromatographic separation employed two solvent phases ...
-
bioRxiv - Synthetic Biology 2024Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were then washed 3 times with TBST for 10 min at room temperature and incubated with horseradish peroxidase coupled secondary antibodies (Dako anti-rabbit #P0448 or anti-mouse #P0447 ...
-
bioRxiv - Microbiology 2024Quote: The separation was performed using a ZORBAX RRHD Eclipse Plus (C18, 3 × 50 mm, 1.8 μm; Agilent Agilent 959757-302) or a Poroshell 120 EC-C18 ...
-
bioRxiv - Microbiology 2024Quote: The separation was performed using a ZORBAX RRHD Eclipse Plus (C18, 3 × 50 mm, 1.8 μm; Agilent Agilent 959757-302) or a Poroshell 120 EC-C18 ...
-
bioRxiv - Immunology 2024Quote: ... cDNA and libraries were made using the Lexogen QuantSeq 3’ mRNA-seq FWD library prep kit and quality was assessed by Agilent High Sensitivity DNA kit on a Bioanalyzer (Agilent) ...
-
bioRxiv - Biochemistry 2024Quote: ... The effect of PFKFB2/3 inhibitors on glycolysis was determined by glycolysis stress test utilizing Seahorse XFe24 Extracellular Flux Analyzer (Agilent) measuring extracellular acidification rate (ECAR ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2024Quote: ... sections were washed in PBS three times for 3 minutes each before being incubated with DAKO Rabbit/Mouse HRP Kit-provided HRP (Mouse-K4001, Rabbit-K4003; Dako) for 30 minutes at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... Serotec) mouse monoclonal antibodies, or Aβ40 (1:200, Covance), Iba-1 (1:200, Wako) and GFAP (1:1000, DAKO) rabbit polyclonal antibodies ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mL of the cell suspension was loaded into a quartz cuvette (Agilent Technologies). Fluorescence was measured with an Agilent Cary Eclipse fluorescence spectrophotometer with slit widths at 5 and 10 nm for excitation wavelength of 370 nm and emission wavelength of 415 nm ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µg amplified cDNA was Cy5-labeled using the SureTag DNA labeling kit (Agilent). Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome ...
-
bioRxiv - Microbiology 2021Quote: ... unfrationated 2-5A oligomers were run on an HPLC (1260 Infinity II Agilent technologies) equipped with a preparative Dionex column (BioLCRDNAPacRPA-100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and -2 of the zymogen sequence of KLK3 (Quick Change Lightning Mutagenesis Kit; Stratagene) enabled furin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stainings were visualized using Liquid DAB+ 2-component system (3,3’-diaminobenzidine, DAKO, Agilent K3467) following the manufacturer’s protocol and washed three times with TBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stainings were visualized using Liquid DAB+ 2-component system (3,3’-diaminobenzidine, DAKO, Agilent K3467) following the manufacturer’s protocol and washed three times with TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed 2 times with XF DMEM assay medium (Agilent, #103575-100), supplemented with glucose (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR assays were analyzed with 2(-ΔΔCt) method 85 via MxPro software (Stratagene) and expressed as relative quantity to normalizer 86.
-
bioRxiv - Neuroscience 2022Quote: ... the slides were exposed to a mouse-specific biotinylated secondary antibody (GV82111-2, Dako) for 15 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 500 ng of F(ab’)2 fragments of α-μ (clone JDC-15; Dako [α-human] ...
-
bioRxiv - Genomics 2020Quote: ... and two Peltier thermal stations (CPAC Ultraflat HT 2-TEC, #7000166A, Agilent Technologies, USA) with PCR adapter having a mounting frame at positions 4 and 6 on the Bravo Deck and connected to an Inheco MTC Controller ...
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and 2) size distribution using the High Sensitivity DNA BioAnalyzer kit (Agilent, 5067-4626). Libraries were constructed using the Nextera XT library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with primary antibodies diluted in background reducing antibody diluent (Agilent S302283-2) overnight at RT ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mM glutamine and analyzed with an XF-96 Extracellular Flux Analyzer (Agilent). Four consecutive measurements were obtained under basal conditions followed by the addition of 1 μM oligomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µM Antimycin A + Rotenone (Seahorse XF Cell Mito Stress Test Kit, Agilent) was added sequentially via injection ports ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by HRP-conjugated anti-mouse secondary antibody polymer (EnVision+; Dako-Cat# K400311-2) and visualized by Cy7-tyramide as substrate ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM glutamine and 10 mM glucose (All from Agilent, Santa Clara, CA, USA). The plates were read using a XF HS Mini analyser (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... [low antigen retrieval (AR) solution] or in EDTA buffer pH 8.0 (Dako; #K800421-2) [high antigen retrieval (AR ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 µM Antimycin A + Rotenone (Seahorse XF Cell Mito Stress Test Kit, Agilent) were added sequentially to the Agilent Seahorse XFe96 Extracellular Flux Analyzer via injection ports to determine basal and maximum respiration ...
-
bioRxiv - Neuroscience 2024Quote: Protein A/G/L was purchased from Novus Biologicals (NBP2-34985) and diluted to 1ug/ul with antibody diluent solution (DAKO, S080983-2). Two microliters of mouse or human serum/plasma was incubated with NMDAR1-GLUC and 2 ul of protein A/G/L in 1X PBS ...