Labshake search
Citations for Agilent :
951 - 1000 of 1083 citations for 6 Fluoro naphthalene 2 carboxaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Bioengineering 2023Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed in TBST and incubated for 1-2 h with the peroxidase-coupled secondary antibody (HRP-coupled anti-rabbit IgG (Dako, #P0448), HRP-coupled anti-mouse IgG (Dako ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...
-
bioRxiv - Immunology 2021Quote: ... Paraffin sections (4µm thick) of FFPE thymus and lymph node tissues (NMR, mouse, and human control) were stained for cytokeratin (AE1/AE3, Dako GA05361-2) on a Dako Omnis autostainer with pressure cooker antigen retrieval (TrisEDTA ...
-
bioRxiv - Microbiology 2021Quote: ... were acidified with 5 µl of 30% HCl per 2 mL to prevent precipitation and measured by inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent Technologies 5100). Porewater for dissolved inorganic carbon (DIC ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2021Quote: ... Entry clones for other mutant dynamin 2 were prepared by introducing corresponding mutations into the Entry clone of wild type human dynamin 2 using QuikChange Lightning Site-directed Mutagenesis kit (Agilent Technologies, 210518) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Microbiology 2022Quote: ... Sialyl-Lewis a (sLea) and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... Sizes and yields of RACE products (2 µL aliquots) were determined using a Fragment Analyzer (Advanced Analytics; now Agilent, Santa Clara USA) equipped with 55 cm electrophoresis capillaries and reagents capable of resolving dsDNA fragments between 35 and 1500 bp (see Fig 1E) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the tissue was soaked in 200μl dichloromethane containing 200ng 2-tetradecyl acetate (internal standard) in 2ml glass vials with PTFE-coated caps (Agilent, Santa Clara, USA) for one hour ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were washed with TBST and slides were developed by adding AEC+ High Sensitivity Substrate Chromogen Ready to use (Dako K346111-2).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... three washes with phosphate buffered saline (PBS) and the incubation with the primary antibody in the DAKO Real TM antibody diluent (Agilent #S202230-2) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Genomics 2019Quote: ... Gene expression was performed on 7900 HT fast real time PCR system (Applied Biosystem, USA) using 2× Brilliant III SYBR@ Green qPCR Master Mix (Agilent Technologies, USA) and gene specific primers (Supplementary Table 1) ...