Labshake search
Citations for Agilent :
951 - 1000 of 3255 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The blots were washed for 3 x 10 min in 1 x Animal-Free Blocker and incubated for 1 h at room temperature in HRP-conjugated rabbit anti-goat secondary antibody (1:1000, Dako, USA) for 1 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM Vanadyl-ribonucleoside complex NEB S1402S) mixed with 1:3000 dilution of probes and 1:900 dilution of guinea pig anti-Insulin antibody (Dako, A0564). Hybridization mix was incubated with tissues for overnight in a 30°C incubator ...
-
bioRxiv - Immunology 2022Quote: Tissue sections were then incubated with anti-PD1 (1:300, 3G8) and anti-PDL1 (1:100, 1F8) in antibody diluent (Dako, S0809) for 60 min (26) ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM fluoro-carbonyl cyanide phenylhydrazone (FCCP) and 100 nM rotenone + 1 μM antimycin A (all from Agilent, Santa Clara, California) using a 96 well XF Extracellular Flux Analyzer (EFA ...
-
bioRxiv - Cell Biology 2021Quote: ... then primary antibody (anti-SOX9 at 1/200 with 0.1% TritonX-100, ABCAM, Cat # ab185966; anti-KRT19 at 1/100, DAKO Cat # M0888) diluted in diluent (DAKO ...
-
bioRxiv - Cell Biology 2020Quote: ... and the following HRP conjugated secondary antibodies: swine anti-rabbit (1:3000 for embryo levels, 1:10000 for in vitro assays; Dako, P0399) and sheep ECL anti-mouse (1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... membranes were incubated for 45 minutes in 1% dried skim milk in PBS-T with rabbit anti-human C1q (1:300, Dako, A0136) and HRP-conjugated goat anti-rabbit IgG (1:10.000 ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP-conjugated antibodies were used as secondary antibodies (Swine anti-rabbit 1:3000, Goat anti-mouse 1:5000, Dako, Glostrup, Denmark). Membranes were developed with Clarity Western ECL Substrate 1:1 (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... Microglia and Astrocyte proliferation was visualized by staining the brain sections using anti Iba1 (1:2500; WAKO) and anti GFAP antibody (1:1000 Agilent technologies). When appropriate the brain sections were counterstained with haematoxylin and eosin ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated overnight at 4 ⁰C with a cocktail of the primary antibodies αSyn (clone KM51 1:500, Monosan Xtra, The Netherlands) and glial fibrillary acidic protein (GFAP, Z0334, 1:4000, DAKO, Denmark). After rinsing in PBS ...
-
bioRxiv - Immunology 2024Quote: ... The membrane was washed three times in block buffer followed by a 1 h incubation with anti-goat/-rabbit HRP-conjugated secondary antibodies (1:5000, Agilent Dako) at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then incubated in primary antibody (anti-Alk1 Rabbit Abcam #ab68703, 1:100; anti-CD31 Mouse Dako #M0823, 1:500) over-night at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... dried metabolites were resuspended in 50 μL of a 1:1 DMSO to water solution and analyzed by LC-MS using a 1290 Infinity II liquid chromatography (Agilent Technologies) with a thermal autosampler set at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 µM FCCP and 1 µM Rotenone/1 µM Antimycin A from Seahorse XF Cell Mito Stress Test (103015-100, Agilent Technologies), and read using Seahorse XFe96 Analyzer (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Pathology 2024Quote: ... The membrane with fibulin-1 antibodies was washed with TBST three times for total 15 minutes and incubated with a tertiary antibody goat anti-rabbit immunoglobulin-HRP (1:5000 in 1% milk/TBST, Dako P0260) for 45 minutes and subsequently washed with TBST three times for a total of 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... The section was subsequently incubated with primary antibodies (GPNMB,1:500, E4D7P, Cell Signaling & HLA-DR/DQ/DP, 1:1000, M0775, DAKO), in 0.5% Triton-X100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were then incubated with secondary antibodies for 1 h at room temperature (1:10,000 anti-rabbit HRP-immunoglobulins (Dako, Cat#P0448)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×44K (G4112F, Agilent Technologies, Germany).
-
bioRxiv - Neuroscience 2023Quote: ... and 4% normal goat serum (Dako) in PBS for 1 h at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the consumption of NADPH was followed at 30 °C and 340 nm (Δε=6.22 mM-1 cm-1) with a Cary 60 UV-Vis spectrophotometer (Agilent Technologies, Germany).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The reaction was started with different concentrations of 3-butenoic acid and the consumption of NADPH was followed at 30 °C and 340 nm (Δε=6.22mM-1 cm-1) with a Cary 60 UV-Vis spectrophotometer (Agilent Technologies, Germany).
-
bioRxiv - Neuroscience 2020Quote: Mouse brains were analyzed as free-floating sections to localize immunoreactivity for GFAP (Z0334, Dako/Agilent; 1:10,000 primary, 1:10,000 secondary), Iba-1 (019-19741 ...
-
bioRxiv - Cell Biology 2022Quote: ... IgG1a monoclonal antibody in PBS with 1% BSA followed by a bridge step labelling with a polyclonal Rabbit Anti-Mouse Immunoglobulins (Dako, 1:50) and protein A-gold 10 nm (UMC Utrecht ...
-
bioRxiv - Immunology 2020Quote: ... followed by the incubation with horseradish peroxidase-labeled secondary antibody (1:10,000) for 1 h at room temperature (DAKO EnVision™+ System; Agilent Technologies (UK). Diaminobenzidine (DAB ...
-
bioRxiv - Immunology 2020Quote: ... 1:4000, rat anti-mouse IgG3-biotin (Becton, Dickinson, Franklin Lakes, New Jersey) 1:2000 followed by streptavidin-HRP (Dako, Glostrup, Denmark) 1:1000 incubated at 37°C for 1h.
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated for 1 h at room temperature with rabbit anti-glial fibrillary acidic protein (GFAP, 1:300; Dako, Carpinteria, CA), rabbit anti-oligodendrocyte specific protein (OSP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Consecutive slides were incubated with anti-ATM (1:100) or anti-SMA (1:200) diluted in Dako REAL Antibody Diluent (Dako, Glostrup, Denmark). Slides were then treated with biotinylated secondary antibodies and target staining was performed with peroxidase-conjugated streptavidin and DAB chromogen (Dako REAL Detection System Peroxidase/DAB+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated with secondary antibodies diluted in 0.5% WBR in TBST for 1 hour at room temperature (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Agilent Dako #P0448, 1/2000), washed three times with TBST ...
-
Treatment with furosemide indirectly increases inhibitory transmission in the developing hippocampusbioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP, Dako, 1:2500), and washed 3 times 15 minutes in TBST again before chemiluminescence detection ...
-
bioRxiv - Neuroscience 2023Quote: ... sympathetic ganglia and spinal cords was conducted directly on the slides using primary rabbit anti-HSV-1 (1:100; B0114, DakoCytomation, Carpinteria, CA) and chicken anti-GFP (1:400 ...
-
bioRxiv - Immunology 2023Quote: ... The final NGS libraries were obtained using SPRI beads at a 1:1 ratio and quantified with a 4200 TapeStation System (Agilent Technologies, G2991BA). Libraries with a single peak of appropriate length were subjected to NGS analysis using the Illumina Novaseq6000 platform.
-
bioRxiv - Microbiology 2022Quote: ... primary antibody was produced in-house from HB 65 mouse anti-nucleoprotein and diluted 1:2500 followed by HRP-conjugated rabbit anti-mouse diluted 1:500 (Dako, Glostrup, Denmark). The titration was repeated on a different day and TCID50 titres were calculated using Reed and Muench (29).
-
bioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP, Dako, 1:2500), and washed 3 times 15 minutes in TBST again before chemiluminescence detection ...
-
bioRxiv - Bioengineering 2022Quote: ... Incubation with secondary antibodies diluted in blocking solution was performed 1 h at RT: anti-rabbit-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P044801-2; Dako, Carpinteria, CA, USA), anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000 ...
-
bioRxiv - Physiology 2024Quote: ... Each spheroid line was replated in quadruplicates as described previously in 15 µL matrigel domes (8 spheroids/µL) containing a 1:1 mix of Matrigel and OWM into Seahorse XF96 cell culture plates (Agilent #101085-004) and cultured overnight in 150 µL OGM ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-CD44 (1:50, clone DF1485, Dako, M7082), rabbit anti-EGFR (prediluted ...
-
bioRxiv - Cell Biology 2020Quote: ... or goat anti-mouse IgG/HRP (1:5000, Dako) for 1 h at room temperature before being washed ...
-
bioRxiv - Cell Biology 2020Quote: ... horseradish peroxidase-conjugated anti-mouse (Dako, #P0447; 1:4,000) or anti-rabbit IgG (gamma-chain specific ...
-
bioRxiv - Genetics 2021Quote: ... and mouse-anti-Ki67 (Agilent, M7248, dilution 1:100). Goat-anti-mouse-488 and Goat-anti-rabbit-568 were used as secondary antibodies and sections were counterstained with DAPI ...
-
bioRxiv - Cell Biology 2020Quote: ... For the anti-human Fibronectin immunostaining (Dako, 1:1000) a single immunostaining was performed with a goat anti-rabbit secondary antibody and Alexa-568 phalloidin ...
-
bioRxiv - Microbiology 2021Quote: ... then 1:1500 goat anti-mouse IgG-HRP (Dako); 1:1000 anti-HA (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... then 1:1500 goat anti-mouse IgG-HRP (Dako). Membranes were washed for 3 × 5 mins in TBST after each antibody step ...
-
bioRxiv - Developmental Biology 2021Quote: ... A rabbit anti-GFAP (Dako # Z033401-2, 1:250) primary antibody was diluted in blocking solution for incubation at 4°C overnight ...