Labshake search
Citations for Agilent :
51 - 100 of 108 citations for cis Clopidogrel MP 13C d3 Derivative Pair of Enantiomers since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids harboring GlnR amino acid substitutions (pET28a-glnR derivatives) were constructed using site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Agilent, Inc.).DNA fragments consisting of different canonical GlnR-dependent promoters (narG whose downstream genes encoding M ...
-
bioRxiv - Biochemistry 2024Quote: ... Total fatty acyl groups from 1 mg cerebellar protein were quantitated as their pentafluorobenzyl derivatives on a Capillary Gas Chromatography-Electron-Capture Negative-Ion Mass Spectrometry (GC/MS) system (Agilent, USA) with a Supelco SP2560 capillary column (50m X 0.25mm x 0.2µm ...
-
bioRxiv - Immunology 2020Quote: ... succinate and malate and their corresponding 13C labeled counterparts were extracted and deconvoluted using MassHunter software (Agilent Technologies, New Castle, DE). Retention time consistency was manually rechecked and compared to authentic compounds that were injected under similar chromatographic conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... 13C NMR spectrum was recorded on a Varian 500 MHz spectrometer equipped with a 5 mm 1H{13C} XSens cold probe (Varian Inc., Palo Alto, CA, USA, now Agilent Technologies). NMR spectra were referenced to the solvent signals (CHD2OD ...
-
bioRxiv - Biochemistry 2023Quote: ... enterica WbaP Cys-pair variants were generated using primers designed in the quikchange primer tool (Agilent). Successful mutations were confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2023Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 megabase pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq 4,000 (sx75 base-pair paired-end configuration ...
-
bioRxiv - Microbiology 2023Quote: ... The GC-MS system consisted of an Agilent 5973N MSD EI/CI with 6890 GC and autosampler (Agilent Technologies). Acquisition was done using Chemstation software (Hewlett-Packard ...
-
bioRxiv - Neuroscience 2021Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 mega base pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq4,000 (2×75-base-pair paired-end configuration ...
-
bioRxiv - Neuroscience 2021Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 mega base pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq4,000 (2×75-base-pair paired-end configuration ...
-
bioRxiv - Neuroscience 2024Quote: Whole-exome sequencing target enrichment used the SureSelectTX human all-exon library (V6, 58 megabase pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq 4,000 (sx75 base-pair paired-end configuration ...
-
bioRxiv - Plant Biology 2020Quote: ... Elemental analyses were performed using MP-AES (Agilent 4200, Agilent Technologies).
-
bioRxiv - Plant Biology 2020Quote: ... Elemental analyses were performed using MP-AES (Agilent 4200, Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... GCMS measurements were performed on 8890B GC coupled to EI/CI 5977 MSD mass spectrometer using an electron impact ionization extractor ion source (Agilent) as previously described[13].
-
bioRxiv - Microbiology 2021Quote: ... plasmid was reacted with primer pairs designed to introduce the desired mutations using Quikchange kit (Agilent, cat# 600670). After digestion with the restriction enzyme DpnI (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 110-base pair (bp) single strand DNA oligo pool containing Rosetta designed sigma fragments were ordered from Agilent. Oligo design features unique priming regions at 5’ and 3’ for individual libraries complemented with BsaI recognition sites and cutting sites to enable Goldengate cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA concentration and base-pair length were quantified using an electrophoresis device (TapeStation System, Agilent, Santa Clara, CA).
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear magnetic resonance (NMR) spectra including the 1H and 13C NMR spectra were recorded on a Varian Mercury Plus 400 NMR spectrometer (Agilent Technologies, Santa Clara, CA). Proton chemical shifts are reported as parts per million (δ ppm ...
-
bioRxiv - Plant Biology 2020Quote: ... and the K concentrations were analyzed using MP-AES (Agilent Technologies; USA).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... modified for the GC–MS (7890A GC System and 5975C inert XI EI/CI MSD with an EI inert 350 source) and MassHunter Workstation Software (MassHunter, Agilent Technologies). The protocol details have been previously published [23].
-
bioRxiv - Evolutionary Biology 2021Quote: ... Adaptor-ligated fragments about 350 base- pairs (bp) long according to the Agilent 2100 bioanalyzer (Agilent, California, United States) were recovered using size selection ...
-
bioRxiv - Biochemistry 2023Quote: ... GST and GST-fused CBS-pair domain of murine CNNM2 were expressed in transformed BL21 (DE3) cells (Stratagene, CA). Bacterial cells were lysed by sonication in ice-cold PBS containing 1% Triton X-100 and protease inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then assessed fragment and mate-pair library qualities using the High Sensitivity D1000 ScreenTape for the Tapestation (Agilent) and High Sensitivity DNA Kit for the Bioanalyzer (Agilent) ...
-
bioRxiv - Plant Biology 2023Quote: ... and metal content was measured using a 4200 MP-AES spectrophotometer (Agilent technologies) as previously described (García de la Torre et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Microbiology 2023Quote: ... Primers ANB21F and ANB21R and were used to amplify the arcA ORF and 539 base pairs upstream of the start of the gene with Easy A polymerase (Agilent). The PCR product and pBBR1MCS-5 parent plasmid were separately digested with SacI and XbaI ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... An A to C mutation was made at base pair 219 within the CAT-I gene using the QuickChange Lightning Site-Directed Mutagenesis kit (Agilent) to match the native E ...
-
bioRxiv - Neuroscience 2024Quote: ... and silicone gasket was removed with a pair of forceps to allow mounting with DAKO fluorescent mounting medium (DAKO, #S3023). After leaving slides to dry ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR amplicons were subsequently separated by Fragment Analyzer capillary electrophoresis using the DNF905 1-500 base pair kit (Agilent). Bands were quantified and PSI was calculated as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by double-stranded plasmid mutagenesis using the primer pairs listed in Table S1 and a Quikchange Site-Directed Mutagenesis Kit (Agilent Tech.). After verification by DNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... The quality of the libraries is determined using the Standard High sensitivity NGS Fragment analysis kit (DNF-474, 1-6000 base pair) on the Agilent Fragment analyzer (Agilent, USA), yielding approximately 260 bp size fragments ...
-
bioRxiv - Bioengineering 2020Quote: ... yielding library sizes with an average distribution of 500-750 base pairs in length as determined using the Agilent hsD1000 Screen Tape System (Agilent Genomics). Arrays were sequenced within multi-sample pools on an Illumina Nova-Seq through the Broad Institute walk-up sequencing core ...
-
bioRxiv - Biophysics 2020Quote: ... The desired base pairs coding for Cys were introduced using overlapping primers with the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Neuroscience 2021Quote: ... The quality of the libraries is determined using the Standard High sensitivity NGS Fragment analysis kit (DNF-474, 1-6000 base pair) on the Agilent Fragment analyzer (Agilent, USA), yielding approximately 260 bp size fragments ...
-
bioRxiv - Microbiology 2023Quote: ... Microtiter plates containing technical replicates for each antibiotic-berberine pair were incubated for 18 hours with vigorous shaking using in Cytation5 Imaging Reader (Agilent BioTek). OD600 values were recorded every 15 minutes and select time points (0 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was monitored using the xCELLigence MP Real-Time Cell Analysis (RTCA) system (Agilent) as previously described [14] ...
-
bioRxiv - Physiology 2022Quote: ... Concentrations of enriched dsDNA fragments with specific adapters were determined and base pair average size and library integrity were analyzed using the Bioanalyzer DNA High Sensitivity chips (Agilent, Cat. 5067-4626). Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... Concentrations of enriched dsDNA fragments with specific adapters were determined and base pair average size as well as library integrity were analyzed using the Bioanalyzer DNA High Sensitivity chips (Agilent, Cat. 5067-4626). Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... Library fragment-length distributions (mean of 269 ± 18 base pairs) were quantified with High Sensitivity D5000 Reagents (Agilent Technologies; Cat. No. 5067-5593) on the 4200 TapeStation System ...
-
bioRxiv - Cell Biology 2021Quote: ... site-directed mutagenesis was performed on pCRII-mp-EGFP using a QuikChange Lightning mutagenesis kit (Agilent) to introduce two further mutations ...
-
bioRxiv - Neuroscience 2024Quote: ... The library quality was evaluated by measuring the library size in base pairs using the Agilent High Sensitivity DNA Kit and Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA). During the library construction ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2021Quote: ... FACS sorted MPs were plated on XF96 cell culture microplates coated with 10% Matrigel in warm assay medium (Agilent), the cell culture plate was centrifuged with 200 g for 5 min ...
-
bioRxiv - Plant Biology 2021Quote: ... Metal contents present in the samples were then measured by microwave plasma atomic emission spectroscopy (MP-AES, Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: All cytotoxicity assays were performed using the xCELLigence RTCA MP analyzer and 96 well PET E-plates (Agilent Technologies). Assays were carried out in RPMI containing 10% fetal calf serum ...
-
bioRxiv - Microbiology 2023Quote: Samples were analysed using Agilent GC-MS Single Quad (7890/5977) plus Gerstel MultiPurpose Sampler (MPS, Agilent Technologies, USA) following the Agilent G1676AA Fiehn GC/MS metabolomics workflow ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 technical replicates for each time point were analysed using Microwave Plasma - Atomic Emission Spectrometry (MP-AES 4210, Agilent) as reported previously24.
-
bioRxiv - Plant Biology 2024Quote: ... Mineral contents present in the samples were then measured by microwave plasma atomic emission spectroscopy (MP-AES, Agilent Technologies).
-
bioRxiv - Plant Biology 2024Quote: ... and Cu levels was conducted via MP-AES (Microwave Plasma Atomic Emission Spectrometry) (Agilent 4200MP-AES, Santa Clara, CA) at the BPMP laboratory (Montpellier ...
-
bioRxiv - Plant Biology 2022Quote: ... the metal content of the samples was determined by atomic emission spectroscopy using a MP AES 1200 spectrometer (Agilent, USA).