Labshake search
Citations for Agilent :
51 - 100 of 824 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... US-108N mixed deuterated PAH standard (Agilent) was added to the samples as an internal standard prior to analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... as per standard protocols (Agilent Technologies, Inc) with modifications 20 ...
-
bioRxiv - Neuroscience 2022Quote: ... and co-transfected with 129 μg pHELPER (Agilent), 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Genetics 2022Quote: ... and Agilent Bioanalyzer 2100 (Agilent, Loveland, CO, USA). Subsequently ...
-
bioRxiv - Pathology 2023Quote: ... The DAKO EnVision + HRP kit (Dako Co, Denmark) was used as an amplification system.
-
bioRxiv - Microbiology 2021Quote: ... 7.5 µg pHelper (Agilent), 7.5 µg of pAB269-TBG-FLT3 LG-BGH per plate ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA of CFs/HVPs co-culture and conditioned CFs exposed to co-culture medium was extracted using the Absolutely RNA Miniprep Kit (Agilent Technologies, USA) according to the manufacturer’s instructions and 1 μg was reverse transcribed using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... Incubation with primary antibodies to GFAP (Dako, A0063, 1:5000) and IBA1 (WAKO ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti goat HRP conjugated HRP (1/5000, Dako UK) and goat anti-rabbit HRP conjugated (1/5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat anti-rabbit HRP conjugated (1/5000, Dako UK) for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... Swine anti-rabbit polyclonal Ab (1:5000 dilution, DAKO, P0217).
-
bioRxiv - Plant Biology 2024Quote: ... and secondary antibodies α-mouse-HRP (Agilent, P0260, 1:5000), α-rat-HRP (GE HealthCare ...
-
bioRxiv - Neuroscience 2023Quote: ... The following antibodies were used: GFAP (1:5000, Dako, #Z0334) and Hepacam (1:200 ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-rabbit HRP (Agilent, cat #: P0448, 1:5000 dilution).
-
bioRxiv - Cell Biology 2024Quote: ... or Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP (1:5000, Dako), diluted in milk powder ...
-
bioRxiv - Plant Biology 2024Quote: ... against an environmental calibration standard (Agilent 5183-4688), a S (Inorganic Venture CGS1 ...
-
bioRxiv - Microbiology 2022Quote: ... Serum Free (Agilent Dako) for 90 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Serum Free (Agilent Dako) for 90 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Toluene-Free (CS705, Dako) using a Dako CoverStainer ...
-
bioRxiv - Immunology 2023Quote: ... serum free (Dako, USA) at room temperature for 1h in a humidified chamber ...
-
bioRxiv - Immunology 2023Quote: ... serum-Free (DAKO, X0909) for 45 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Toluene- Free (CS705, Agilent) using a Dako CoverStainer ...
-
bioRxiv - Microbiology 2022Quote: Dissolved organics were captured from the acidified filtrate on a solid phase extraction Bond Elut-PPL cartridge (Agilent) (Dittmar et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by HRP-conjugated rabbit anti-rat (1:5000, P0450, Dako). For detection of Btn2-HA ...
-
bioRxiv - Molecular Biology 2022Quote: ... rabbit anti-mouse-HRP polyclonal Ab (1:5000 dilution, DAKO, P0161), Swine anti-rabbit polyclonal Ab (1:5000 dilution ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and Agilent DNA 5000 TapeStation reagents (Agilent, #5067-5588; #5067-5589). Samples were then pooled in equimolar amounts according to the TapeStation results and sequenced on a NovaSeq 6000 system (PE150 on one lane of an S1 Flowcell).
-
bioRxiv - Evolutionary Biology 2024Quote: ... and Agilent DNA 5000 TapeStation reagents (Agilent, #5067-5588; #5067-5589). Samples were then pooled in equimolar amounts according to the TapeStation results and sequenced on a Novaseq 6000 system (PE50 on one lane of an SP Flowcell).
-
bioRxiv - Microbiology 2023Quote: ... wells were incubated with 1:5000 goat anti-mouse HRP (Dako) and incubated for 1 h in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-goat (P0449, Dako, Agilent, CA, USA, WB 1:5000) antibodies were applied.
-
bioRxiv - Bioengineering 2024Quote: ... SWNT concentration was estimated by UV-Vis spectrophotometry (Agilent Cary 5000) using SWNT absorbance at 632 nm with an extinction coefficient of 0.036 (mg L−1)−1 cm−1.
-
bioRxiv - Cell Biology 2024Quote: ... and Goat Anti-Rabbit HRP (Dako, P0448, 1:5000 – 1:20,000).
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-goat (P0449, Dako, Agilent, CA, USA, WB 1:5000) antibodies were applied.
-
bioRxiv - Developmental Biology 2024Quote: ... and Polyclonal goat anti mouse HRP (Dako P0447, dilution 1:5000)
-
bioRxiv - Neuroscience 2020Quote: ... sections were co-incubated with polyclonal rabbit anti-GFAP (Dako) for astrocytes ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sections were co-stained for αSMA (DAKO, M0851, 1:400), detected with biotin-coupled anti-Mouse (DAKO ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations were introduced using standard primer-mediated mutagenesis (Agilent Technologies ...
-
bioRxiv - Genomics 2022Quote: ... or standard capillary electrophoresis Tape Station (Agilent, 5067-5365). 1000 ng of gDNA was used for adapter ligation (Oxford Nanopore Technologies ...
-
bioRxiv - Pathology 2023Quote: ... was utilized following the standard protocol established by Agilent Seahorses ...
-
bioRxiv - Neuroscience 2024Quote: ... and RNA integrity (average: 9.1, standard deviation: 0.48) (Agilent RNA 6000 Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... serum-free (Dako, Glostrup, Denmark) for 1 hour and then incubated overnight at 4C°with anti-rabbit CD31 antibody (1:100 ...
-
bioRxiv - Physiology 2022Quote: ... Toluene-Free (CS705, Dako, Agilent) using a Dako CoverStainer.
-
bioRxiv - Physiology 2022Quote: ... Toluene-Free (CS705, Dako, Agilent) using a Dako CoverStainer ...
-
bioRxiv - Physiology 2022Quote: ... Toluene-Free (CS705, Dako, Agilent) using a Dako CoverStainer ...
-
bioRxiv - Physiology 2022Quote: ... Toluene-Free (CS705, Dako, Agilent) using a Dako CoverStainer.
-
bioRxiv - Physiology 2024Quote: ... Serum-free protein block (Dako) was then applied for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Toluene-Free (CS705, Dako, Agilent) using a Dako CoverStainer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Toluene-Free (CS705, Dako, Agilent) using a Dako CoverStainer ...
-
bioRxiv - Pathology 2023Quote: Sugars and Organic acids were quantified in the RCJ using high-performance liquid chromatography (HPLC) (1200 series, Agilent Technologies) with a diode-array detector (DAD ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1:5000 swine anti-rabbit immunoglobulin HRP conjucated (RRID:AB_2617141, P0399, Agilent).