Labshake search
Citations for Agilent :
51 - 100 of 6183 citations for Rat LIM Domain Kinase 2 LIMK2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-rat (1/1000, Dako), goat anti-rabbit (1/200 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ki67 (Rat, 1:500, Dako, M7249) cleaved Caspase3 (Rabbit ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AR DBD domain DNA fragment was amplified using Herculase II Fusion DNA Polymerase (Agilent Technologies; cat. 600677) with 36 cycles and annealing at 63.5°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Quikchange 2 Site-Directed Mutagenesis Kit (Agilent Technologies 210518) was used to introduce the two mutations ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-rat and anti-rabbit antibodies (Dako).
-
bioRxiv - Neuroscience 2023Quote: ... Rat-anti-Ki67 (DakoCytomation, M7249; 1:200); Rabbit-anti-PH3 (Ser10 ...
-
bioRxiv - Pathology 2023Quote: ... rat and rabbit were obtained from DAKO. The secondary antibodies used for immunofluorescence ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Biophysics 2023Quote: ... A non-cleavable T855G mutant of this Lphn3 GAIN domain fusion protein was generated using QuikChange II XL (Agilent) site-directed mutagenesis with primers 5’-ATG CAG CTG TAA TCA CCT GGG CAA CTT TGC TGT CCT GAT G -3’ and 5’-CAT CAG GAC AGC AAA GTT GCC CAG GTG ATT ACA GCT GCA T -3’.
-
bioRxiv - Biochemistry 2023Quote: ... GST and GST-fused CBS-pair domain of murine CNNM2 were expressed in transformed BL21 (DE3) cells (Stratagene, CA). Bacterial cells were lysed by sonication in ice-cold PBS containing 1% Triton X-100 and protease inhibitor phenylmethylsulfonyl fluoride (Sigma–Aldrich) ...
-
bioRxiv - Biophysics 2019Quote: Human CAMSAP1 residues 1474-1613 encompassing the CKK domain (HsCKK) were cloned into pET28a vector and expressed in BL21(DE3) cells (Stratagene). Following purification via immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Immunology 2019Quote: ... mutant with Cys20 to Arg and Cys23 to Ser mutations in the RING1 domain was made by site-directed mutagenesis using Quickchange (Stratagene) with primers CCGCTGGTGTCTAGAAAGCTCAGTCTTGGGGAGTAC and GTACTCCCCAAGACTGAGCTTTCTAGACACCAGCGG ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Cell Biology 2020Quote: ... including glutathione S-transferase (GST)-NEPH1 cytoplasmic domain (CD) and GST-NEPHRIN CD were expressed and purified from Escherichia coli BL21 cells (Stratagene). Purified phosphorylated GST-NEPH1 was expressed and purified from TKB1 cells (Stratagene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... first an AgeI cut-site was knocked into the pcDNA3.1-Myoferlin-HA plasmid immediately prior to the transmembrane domain by site-directed mutagenesis (Agilent: 210518). Second ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Biophysics 2023Quote: Yeast eIF4G was purified as described previously.46 A pTYB2 vector encoding a C-terminal fusion of eIF4G with an intein and chitin-binding domain was transformed into BL21 CodonPlus RIL cells (Agilent). Protein expression was induced with 0.5 mM IPTG for overnight at 16 °C ...
-
bioRxiv - Immunology 2023Quote: ... in the α3 domain of HLA-A*02:01 described to abrogate binding of CD8 (13) were changed by site-directed mutagenesis (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... For secondary antibody staining, either ImmPRESS kits (anti-goat, MP-7405; anti-rat, MP-7444) or Envision+ Reagents (Dako: rabbit, K4002) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... the biotinylated rabbit anti-rat secondary antibody (DAKO) was applied ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit-anti-mouse/rat-GFAP (1:3000, Dako), and Mouse-anti-mouse/rat-NeuN (1;200 ...
-
bioRxiv - Genetics 2021Quote: ... as well as a kinase-dead control (K396H) 16,were generated by single-site mutagenesis (Agilent 210518) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Note that all other characteristics observed for a retrotransposon insertion when using the exome capture kit from Roche (see Figure 2) are also observed when using the kit from Agilent.
-
bioRxiv - Cancer Biology 2023Quote: ... and finally 50 μM 2-deoxy-glucose (2-DG) + 1μg/μL Hoechst (Seahorse XF Glycolysis Stress Test Kit, Agilent, 103020) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... the gene coding for the kinse domain of the Elk receptor was amplified from TKB1 cells (Agilent Technologies, Santa Clara, CA) and cloned with a C-terminal HA-tag between NdeI and EcoRV restriction sites within the second open reading frame of the pCDF-Duet vector ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Plant Biology 2023Quote: ... the pET-28a plasmid bearing WT CG-1 domain or its six-point mutants (M1 to M6) were transformed into BL21-Codon Plus (DE3)-RIL (Stratagene, USA) cells ...
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat and rabbit nonimmune IgG (Dako or ThermoFisher Scientific) at the corresponding antibody concentration to verify absence of unspecific antibody binding ...
-
bioRxiv - Immunology 2019Quote: ... Immunoreactions were detected using biotinylated donkey anti-rat (Dako) and goat-anti-rabbit (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... then 1:1500 goat anti-rat IgG-HRP (Dako); anti-histone H4 (Abcam) ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Molecular Biology 2020Quote: ... EcoRV and SacI restriction sites that flanked the B3 domain were introduced into the VP1-TOPO plasmid by site-directed mutagenesis (Agilent Technologies, CA); 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... TMEM24(ΔBS + 5S → E)-eGFP was generated using site-directed mutagenesis to remove a portion of the C-terminus of TMEM24(5S → E)-eGFP including the first 3 β-strands of the β-sheet band 4.1 interacting domain (Quik-Change II XL; Agilent Technologies).TMEM24(5S → E)-eGFP which has been previously described (Sun et al. ...
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µg amplified cDNA was Cy5-labeled using the SureTag DNA labeling kit (Agilent). Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome ...
-
bioRxiv - Cancer Biology 2020Quote: ... and -2 of the zymogen sequence of KLK3 (Quick Change Lightning Mutagenesis Kit; Stratagene) enabled furin ...
-
bioRxiv - Immunology 2020Quote: ... and 2) size distribution using the High Sensitivity DNA BioAnalyzer kit (Agilent, 5067-4626). Libraries were constructed using the Nextera XT library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µM Antimycin A + Rotenone (Seahorse XF Cell Mito Stress Test Kit, Agilent) was added sequentially via injection ports ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibody (horseradish peroxidase coupled rabbit anti-rat IgG, Dako) was diluted 1:2500 in 1% blocking solution and incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-rabbit and anti-rat HRP-conjugated secondary antibodies (Dako). ECL detection was carried out using the Immobilon Crescendo HRP substrate (Millpore ...
-
bioRxiv - Pathology 2023Quote: ... incubated with HRP-conjugated rabbit anti-rat IgG (P0450, Dako) (1:1000 in 1% BSA in TBST) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Biochemistry 2023Quote: ... Each of the 430 compounds from a SelleckChem Kinase Inhibitor Library (catalog #L1200) were combined at 100 μM in wells of a polypropylene 96-Well Tube Plates (Agilent) with TcPINK1 KD at 0.5 mg/mL (approximately 10 μM ...