Labshake search
Citations for Agilent :
51 - 100 of 698 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mL capacity (Agilent Cat. #: 5185-5991) and centrifuged at 17,172 × g for 45 min at 4 °C ...
-
The integrated stress response promotes macrophage inflammation and migration in autoimmune diabetesbioRxiv - Immunology 2024Quote: ... and anti-insulin (Dako; IR002; 1:4) antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... (4) CD68 (Macrophages, 1:400, M0876; Dako)–Opal 620 ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Cell Biology 2022Quote: ... grown cells were blocked with 1x PBS containing 3% goat serum (DAKO) for 30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA expression was measured using SYBR green on a QuantStudio 3 (Agilent). Probes were generated using NCBI primer blast and are listed in Table X ...