Labshake search
Citations for Agilent :
51 - 100 of 1021 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-time PCRs were carried out in Agilent AriaMx Real-time PCR System (Agilent technologies, CA, US). The comparative ΔΔCt method (Livak and Schmittgen ...
-
bioRxiv - Microbiology 2020Quote: ... Each real-time PCR was performed in triplicate on the Stratagene Mx3005P real-time PCR system (Agilent). The reaction mixture was incubated for 15 min at 95°C ...
-
bioRxiv - Genetics 2022Quote: ... Both the RT-PCR and HRM steps were performed on the ArialMx Real time PCR instrument (Agilent). PCR was performed in 12 μL containing 6 μL Kapa HRM-Fast Master mix (Roche) ...
-
bioRxiv - Genetics 2024Quote: ... The quantitative PCR (qPCR) amplification was carried out in a MX 3005 real-time PCR system (Agilent) using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cloned using StrataClone PCR cloning kit (product no: 240205, Agilent technologies Sweden AB, Kista) and re-amplified with M13F/M13R primers using DreamtTaq (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (5 ng cDNA/well) was performed by using QuantiNova kit on Mx3500P PCR machine (Stratagene). Gene-specific primers were used for end-point PCR (HotStarTaq Plus DNA Polymerase ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were ligated into pSC-A vectors using a Blunt-end PCR cloning kit (Agilent #240207). Ligated plasmids were transformed into XL-1 blue competent cells ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR amplification was performed by the use of an MX3000P Multiplex Quantitative PCR System (Stratagene, CA, USA). Data analysis was carried out with MxPRO qPCR software (Stratagene ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The expression pattern of CYP6P9a and CYP6P9b was assessed by quantitative real time PCR (qRT-PCR) (Agilent MX3005) to assess the correlation between the presence of the 6.5kb SV and the expression pattern of these two resistance genes.
-
bioRxiv - Physiology 2020Quote: ... Real-time PCR was carried out using an AriaMx real-time PCR system (Agilent Technologies, Santa Clara, CA) to measure mRNA levels ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The relative transcript accumulation of NaTPS25 was measured using RT-PCR on a Stratagene MX3005P PCR cycler (Stratagene). The elongation factor-1A gene ...
-
bioRxiv - Immunology 2022Quote: ... Knockout PCR products were cloned into pSC-B-amp/kan with the StrataClone Blunt PCR Cloning Kit (Agilent) and Sanger sequenced to determine the exact deletion ...
-
bioRxiv - Microbiology 2020Quote: were performed in triplicate in white 96-well PCR plates (4titude) using a RT-PCR machine (MX3005P, Agilent) with excitation and emission filters of 492 and 585nm ...
-
bioRxiv - Genomics 2021Quote: ... the PCR was performed in triplicate per ligation reaction using the Herculase II PCR reagents (Agilent Technologies, 600677). The parallel library preparations and PCR reactions were subsequently pooled for each reaction.
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative RT-PCR was performed using the MX3000p Real-Time PCR System (Agilent Technologies, Santa Clara, CA, USA) to determine the mRNA expression levels of SOS1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR analysis was performed with SYBR Premix Ex Taq II on AriaMx Real-time PCR system (Agilent). Specific primer sets for age-related genes and housekeeping gene were used ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using PerfeCTa SYBR Green Fastmix (Quantabio) on a AriaMx Real-time PCR System (Agilent, US under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... and AriaMx Real-Time PCR System (Agilent). Relative gene expression was normalized to internal control genes ...
-
bioRxiv - Plant Biology 2021Quote: ... in real time PCR (Agilent Technologies, USA) detection system ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The AriaMX real-time PCR system (Agilent) served for thermal cycling of the duplicate samples with the recommended conditions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... qRT-PCR was performed by MX3000P(Agilent) using UltraSYBR Mixture (Low ROX ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using AriaMX (Agilent) with 12.5 μl of either Power SYBR Green master mix or Taqman master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was performed using SybrGreen (Agilent) on the AriaMX (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... and AriaMx Real-time PCR Systems (Agilent). TBEV forward primer (5’-3’ GGGCGGTTCTTGTTCTCC) ...
-
bioRxiv - Biochemistry 2021Quote: ... For PCR mutagenesis PFU Ultra Polymerase (Stratagene) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... A Real-Time PCR Mx3005p machine (Stratagene) was used to record fluorescence ...
-
bioRxiv - Biophysics 2023Quote: ... PCR site directed mutagenesis kit (Agilent Technologies) was used according to the instruction manual for mutagenesis PCR.
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were confirmed by Tapestation (Agilent), and cleaned up with ExoSAP-IT (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... on AriaMx qRT-PCR system (Agilent Technologies). The following primers were used ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products of positive clones were then cloned into competent cells using the StrataClone PCR Cloning Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplification was carried out using the Paq5000 Hotstart PCR Master Mix following the manufacturer’s protocol (Agilent, USA). Cycling was performed on an Applied Biosystems Thermal Cycler with cycles consisting of an initial denaturation step at 95°C for 2 min ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting PCR products were subcloned into the holding vector pSC-B (StrataClone Blunt PCR Cloning Kit, Agilent Technologies) and 16 colonies (white ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplicons were further cloned into a pSC-amp/kan vector using StrataClone PCR cloning kit (240205, Agilent Technologies). We picked ∼20-50 single colonies per sample to determine the presence ...
-
bioRxiv - Plant Biology 2023Quote: ... The obtained cDNA was used as a template for semiquantitative RT-PCR or Real Time PCR amplification in an AriaMx 1.6 (Agilent). When expression was analyzed using Real Time PCR ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative PCR was performed using the 1-Step Brilliant II SYBR Green QRT-PCR Master Mix kit (Agilent Technologies) and the TaqPath 1-Step Multiplex Master Mix kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies, La Jolla, CA). The Spic promoter was cloned into pGL3-Basic (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... single strand cDNA synthesis and PCR amplification were carried out in a 1-step reaction using the Brilliant II QRT-PCR Master Mix (Agilent) and TaqMan gene expression assays (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... The 481 bp ywhaz amplicon was generated by PCR reaction and cloned into a plasmid using the StrataClone PCR cloning Kit (Agilent). The plasmids were collected and purified using GeneJET Plasmid Maxiprep Kit (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Transcribed cDNA was diluted ten-fold and used for real-time quantitative PCR (QuantiTect SYBR Green PCR Kit; Quiagen; 204145) performed with the MX3005P thermocycler (Stratagene).
-
bioRxiv - Microbiology 2020Quote: ... prior to PCR analysis following manufacturer’s guidelines (Agilent). Gene-specific TaqMan probes (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions employed Pfu DNA polymerase from Agilent Technologies® ...
-
bioRxiv - Microbiology 2022Quote: ... using a AriaMx Real-Time PCR system (Agilent).
-
bioRxiv - Microbiology 2022Quote: ... using a AriaMx Real-Time PCR system (Agilent). The relative quantitation of target mRNA levels was performed by using the 2-ΔΔCT method ...
-
bioRxiv - Genomics 2020Quote: ... PCR3 products were PCR-purified and Tapestation (Agilent) was used to quantify and pool samples for NGS.
-
bioRxiv - Genomics 2020Quote: ... An AriaMx Real-time PCR System (Agilent Technologies) was used for quantification of RNA levels and the X0 method was used for calculations of relative RNA levels (76 ...