Labshake search
Citations for Agilent :
51 - 90 of 90 citations for Flumoxef sodium impurity P since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... the flies were cold anesthetized and collected into an amber glass 2 mL vial (Agilent, P/N 5190-9590) fitted with a 150 µL glass insert (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... and capillary electrophoresis sodium dodecyl sulphate (CE-SDS; protein 230, BioAnalyzer 2100, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Immunology 2022Quote: ... Solid phase extraction was performed on methanol and sodium acetate conditioned Bond Elut Certify II cartridges (Agilent). After loading the samples ...
-
bioRxiv - Biophysics 2021Quote: ... The samples were heated up with a ramp rate of 1 °C/min over a temperature range of 15-95 °C using the qPCR System MX 3005 P (Stratagene). Measurements were performed in triplicate ...
-
bioRxiv - Bioengineering 2022Quote: ... approximately one-million cells were incubated in the FCM buffer with biotinylated ACE2 peptidomimetics (h-deface2 and p-deface2) labeled with Streptavidin-phycoerythrin (SA PE, Prozyme) at the indicated protein concentrations (for one hour at 4°C in the dark ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Then quantification of viral copy numbers was carried out in duplicate by quantitative PCR using a Mx3005 P Thermocycler (Agilent) as described by [49] ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... Mutations in the pCEFL-HA-HaloTag-P-Rex1 WT construct were created by QuikChange II site-directed mutagenesis (Agilent 200523). All constructs were confirmed by sequencing and expression was tested by immunoblot.
-
bioRxiv - Plant Biology 2024Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Cancer Biology 2020Quote: ... pre-coated XF96 plates at 105 cells/well in 175 μL of sodium bicarbonate-free XF Base (Agilent) media freshly supplemented with 10 mM glucose ...
-
bioRxiv - Immunology 2022Quote: ... The resulting cDNA (equivalent to 500ng of total RNA) was amplified using the SYBR Green real-time PCR kit and detected on a Stratagene Mx3005 P (Agilent Technologies). qPCR was conducted using forward and reverse primers (sequences available upon request) ...
-
bioRxiv - Physiology 2021Quote: ... IHC analysis of the protein expression of nutrient transporters was performed as follows: sections were incubated in 1X sodium citrate (pH 6.0) target retrieval solution (Dako) at 95°C for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Oxygen consumption rates (OCR ...
-
bioRxiv - Cell Biology 2024Quote: ... The media was then replaced with DMEM without Sodium Bicarbonate (pH 7.4) before analysis with the Seahorse XFe24 Analyzer (XF mito stress test, Agilent). Specific mitochondrial inhibitors were dissolved in DMEM and loaded into the injector ports of the Seahorse Sensor Plates ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed on the pGAMA-YAP construct to create p-GAMA-YAP-S127A using the QuikChange Lightning kit (Agilent Technologies #210513). Forward primers used for the Ser-to-Ala substitution was as follows ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were subjected to antigen retrieval (Sodium Citrate 10mM, pH=6.0) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were subjected to antigen retrieval (Sodium Citrate 10mM, pH=6.0) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
bioRxiv - Cancer Biology 2021Quote: Biopsy sections were deparaffinized and antigens were retrieved by boiling in 10mM sodium citrate buffer pH6 for 40 minutes followed by endogenous biotin blocking (Agilent) and normal goat serum blocking (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5µm sections were deparaffinized with xylene and rehydrated through graded ethanol washes followed by antigen retrieval in sodium citrate buffer (10 mM, pH 6.0) with a pressure cooker (Dako, Carpinteria, CA), blocked ...
-
bioRxiv - Immunology 2024Quote: ... we washed cells twice with 200 μL of assay medium (minimal DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine (Agilent Technologies)) ...
-
bioRxiv - Genomics 2021Quote: ... A mouse monoclonal anti-p63 antibody (1:500, MS-1081-P, Neomarkers, Fremont, CA, USA) and followed by a secondary kit (Mouse Envision, DAKO-Agilent, Santa Clara CA, USA), stained with chromogen (3,3′-Diaminobenzidine [DAB] ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphorylated tau (PHF1; 1:1000, kind gift of P. Davies (Pensalfini et al., 2020) and total tau protein (Agilent Cat# A0024, RRID:AB_10013724; 1:5000). All the secondary antibodies for western blot analyses were used according to the manufacturer’s recommendations (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Plant Biology 2024Quote: ... and the size of the library fractions were estimated from a smear analysis performed on the FEMTO Pulse® System (Agilent, P/N M5330AA).
-
bioRxiv - Cell Biology 2021Quote: ... and deparaffinized prior to antigen retrieval in 0.1M sodium citrate pH6 and staining with guinea pig anti-insulin antibody (Dako A0564, 1:250) overnight at 4 degrees in the dark and visualized with Anti-Guinea Pig biotin conjugated antibody (Vectastain BA7000 ...
-
bioRxiv - Pathology 2024Quote: ... and antigen retrieval was carried out using a sodium citrate buffer (10 mM, pH 6 or 9) on a PT Link system (DAKO, CA, USA). Endogenous peroxidase blockade was done using 3% hydrogen peroxide (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... Stimulated BMDMs were washed with XF media (non-buffered RPMI-1640 containing 2 mM L-glutamine and 1 mM sodium pyruvate; Agilent Seahorse XF24) and incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Concentrations of extracellular metabolites and putative alcoholic contaminants of NAD(P)H substrates were analyzed by high-performance liquid chromatography (HPLC) on an Agilent 1100 HPLC (Agilent Technologies, Santa Clara, CA USA) with an Aminex HPX-87H ion-exchange column (BioRad ...
-
bioRxiv - Genomics 2021Quote: ... A mouse monoclonal anti-p63 antibody (1:500, MS-1081-P, Neomarkers, Fremont, CA, USA) and followed by a secondary kit (Mouse Envision, DAKO-Agilent, Santa Clara CA, USA), stained with chromogen (3,3′-Diaminobenzidine [DAB] ...
-
bioRxiv - Neuroscience 2020Quote: ... and heat-induced antigen retrieval was performed using 10mM sodium citrate solution (pH 6.0, pSer129) or citrate Target Retrieval Solution (Dako #S169984-2, pH 6.1) with 0.05% Tween-20 (conformation-specific ...
-
bioRxiv - Cell Biology 2024Quote: ... Sections were heated with sodium citrate (pH=6) for antigen retrieval and blocked with a Protein Block reagent (Dako, Santa Clara, CA, USA) for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Antigen retrieval using a standard pH 6 sodium citrate buffer (BioGenex) was performed and sections were stained with Monoclonal Mouse Anti-Human CD45 (Dako, M0701, dilution 1:200) using the M.O.M ...
-
bioRxiv - Cancer Biology 2024Quote: ... Blocking was performed in 0.03% H2O2 containing sodium azide for 5 minutes and primary antibodies (Table S1) were incubated for 60 minutes before detection (Dako EnVision+ System-HRP labeled Polymer) for 30 minutes and development for 5 minutes ...