Labshake search
Citations for Agilent :
51 - 100 of 2559 citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 6 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Immunology 2020Quote: ... CK5/6 (Dako/IR780), p40 (Zytomed/MSK097) ...
-
bioRxiv - Synthetic Biology 2021Quote: 384 well qPCR reaction plates for the multiplexed activation of endogenous genes (Figure 5 and 6) were set up using the Brilliant II SYBR master mix (Agilent cat #600828) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µl of the sample was injected onto a BioSEC-3 300 or BioSEC-5 1000 column (Agilent Technologies) pre-equilibrated with PBS or 10 mM histidine ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Immunology 2024Quote: ... then in 3% hydrogen peroxide for 15min and in serum-free protein block solution (Dako, Cat # X090930-2) for 30min ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Cell Biology 2024Quote: ... Citrate pH 6 1X (Agilent) at 70°C for 40 minutes ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted fatty acids were derivatized with pentafluorobenzyl bromide (PFB) and analyzed in the negative ion mode by gas chromatography-mass spectrometry (GC-MS/MS Agilent HP7890B/7000C). The gas chromatograph was performed at the Functional Lipidomics platform ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...