Labshake search
Citations for Agilent :
51 - 100 of 2313 citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... pH 9 (S2367, Dako, Glostrup, Denmark) in a microwave oven for antigen retrieval ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Immunology 2021Quote: ... Epitope retrieval was performed at 97C for 10 min with the Dako Target Retrieval Solution pH 9 (Agilent, S236784-2) on a Lab Vision PT Module (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was passed up and down through a 29-gauge needle 6-8 times and the fragment size distribution was determined (∼30 kbp; TapeStation, Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... pH 9 (Agilent Technologies, Santa Clara, CA). The sections were incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sections were immunostained using EnVision and ARK kits (DAKO, K400311-2 and K395411-8) according to manufacturer protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Genomics 2019Quote: ... Androgen Receptor (Dako, M3562, 1/200, pH 9). Slides were digitalized using a Hamamatsu NanoZoomer slide scanner (Japan ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Genetics 2021Quote: ... and cultured chondrocytes of children (six girls and six boys) using catalog one-color microarrays (SurePrint G3 Human Gene Expression microarray, 8 × 60 k format; Agilent Technologies, Santa Clara, CA, USA). The data were analyzed using GeneSpring software (version 14.9 ...
-
bioRxiv - Genomics 2020Quote: ... a plasmid encoding the replicases of AAV serotype 2 and the capsid of AAV serotype 9) and pHelper (Agilent Technologies, lab reference pZMB0088) which provides AAV adenoviral helper functions ...
-
bioRxiv - Microbiology 2022Quote: ... 8×15K (Agilent) was customized in order to include different sets of probes as indicated elsewhere (Beites et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Neuroscience 2019Quote: ... and with Target Retrieval Solution (pH 9, Agilent, Dako) for the poly(GP ...
-
bioRxiv - Neuroscience 2019Quote: ... and with Target Retrieval Solution (pH 9, Agilent, Dako) for the poly(GP ...
-
bioRxiv - Bioengineering 2019Quote: ... and Ki-67 (DakoCytomation clone 39-9, Glostrup, Denmark) (dilution 1/50 ...
-
bioRxiv - Immunology 2021Quote: ... using D5000 screentape (Agilent, Cat no. 5067-5588/9).
-
bioRxiv - Developmental Biology 2023Quote: ... RNAs were quality assessed (Agilent 2100 Bioanalyzer, RIN>9) and RNA libraries were prepared using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... One-Color (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... one color (Agilent Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Molecular Biology 2019Quote: ... Purified RNA had 260/280 ratios ~2 (via Nanodrop 2000c, ThermoFischer Scientific, Waltham, MA) and RNA integrity number (RIN) scores >9 (via Bioanalyzer, Agilent Technologies, Santa Clara, CA). Human fetal cardiac fibroblasts (CFs ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Amino acid substitutions or deletions were introduced into the pSARS-CoV-2-Strunc expression vector by site-directed mutagenesis (Stratagene, La Jolla, CA) using mutagenic oligonucleotides as follow:
-
bioRxiv - Bioengineering 2021Quote: ... The serial dilution was prepared by the robotic liquid handler in a 6 × 8 (48-well square) deep well plate (Agilent Part number 201306-100) according to the DilutionPlan (Section 3.1.3) ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Biophysics 2020Quote: ... Calibration curves of individual and mixed amino acids were prepared using either 250 pmol stocks of corresponding individual amino acids or a 250 pmol amino acid standard mix (Agilent #5061-3331). Quantification was performed using calibration curves of the respective amino acid standards.
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA integrity values of 9-10 (Bioanalyzer, Agilent Technologies). Gene-specific primers and dual-labelled probes (labelled with 6-carboxyfluorescein and BHQ-1 ...
-
bioRxiv - Bioengineering 2022Quote: ... pAAV2/9 and a helper plasmid (Stratagene, La Jolla, CA) as previously described92 ...
-
bioRxiv - Neuroscience 2019Quote: ... samples for RNA-seq had RIN values >9 (BioAnalyzer, Agilent). 500 ng of purified RNA was used to prepare libraries for sequencing using the Truseq m RNA l ibrary prep kit (I l lumina RS-122-2001/2) ...
-
bioRxiv - Bioengineering 2024Quote: ... 8 U/mL (Prozyme) – 400 U/mL (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed for 5 minutes using 1X Wash Buffer and then blocked by adding 8 drops of Protein Block Serum-Free (Agilent). Primary antibodies were diluted in diluent (Dako ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... The concentration of amino acids was determined by Agilent 1260 HPLC system ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...