Labshake search
Citations for Agilent :
51 - 100 of 4757 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Bioengineering 2021Quote: ... and incubated overnight at 4 °C with primary antibodies: Anti-GFAP 1:1000 (Z0334, Dako), Anti-CD68 1:400 (MCA1957 ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative analysis was performed using a HP-5MS capillary column (5% phenyl-methyl-siloxane, 30 m x 250 mm, 0.25 mm film thickness; Agilent) with helium carrier gas at 1.5 mL/min ...
-
bioRxiv - Plant Biology 2024Quote: ... using a HP-5MSI 5% phenyl methyl silox with 30 m × 250 µM × 0.25 µm film thickness (Agilent Technologies). Identification and quantification were conducted using AMDIS (Automated Mass spectral Deconvolution and Identification System ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting 1-O-methyl-glycoside TMS derivatives were analysed by GC-MS (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Microbiology 2021Quote: Headspace CO concentrations were monitored every 2-4 days using an Agilent 6890N gas chromatograph (GC; Agilent Technologies, California, US) equipped with a nickel catalyst methaniser (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Cell Biology 2022Quote: ... Derivatized samples were analyzed using an Agilent Technologies 7890B gas chromatographer with a HP-5MS 5% phenyl methyl Silox column (Agilent) coupled to an Agilent Technologies 5977A mass spectrometer ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Free-floating sections were incubated overnight (4 °C) with rabbit anti-GFAP (1:500; DAKO, Z0334). The antibody was prepared in 10% donkey serum in PBS containing 0.02% sodium azide and 0.3% triton X-100 ...
-
bioRxiv - Immunology 2024Quote: ... at 4 °C ON and afterward incubated with rabbit anti-HA antibody 1:2000 (Dako, A0001) 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with anti-GFAP (1:500, Rb, IgG1, Dako, Z0334), anti-IBA1 (1:500 ...
-
bioRxiv - Immunology 2024Quote: ... Samples were incubated overnight at 4°C in anti-insulin antibody (1:500 Dako, Agilent Technologies), washed in 3 times in PBS and incubated for 1 h at room temperature in Alexa 594 goat anti-guinea pig secondary antibody (1:200 ...
-
bioRxiv - Immunology 2024Quote: ... Samples were incubated overnight at 4°C in anti-insulin antibody (1:500 Dako, Agilent Technologies), washed in 3 times in PBS and incubated for 1 h at room temperature in Alexa 594 goat anti-guinea pig secondary antibody (1:200 ...
-
bioRxiv - Genetics 2021Quote: ... Samples with a 260/280 nm absorbance ratio > 1.8 and a 260/230 nm absorbance ratio > 2 were labeled and hybridized to the Tomato Gene Expression Microarray 4 × 44K (Agilent Technologies) as previously described (Coppola et al. ...
-
bioRxiv - Microbiology 2020Quote: ... for 2hrs at 40°C and then incubated over-night at 4°C on a rotating wheel with 2 μg of anti HBc antibody (Dako B0586). Immune-complexes were captured with protein A/G magnetic beads ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 μl of 2 – 4 mg/ml protein samples were applied to a column using the 1260 Infinity HPLC system (Agilent Technologies) coupled to a MiniDawn Treos detector (Wyatt Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... at 4°C overnight followed by incubation with Dako EnVision+System-HRP Labelled Polymer Anti-Mouse (Aglient Dako, Cat # K400111-2) for 60 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked using 10% Normal Goat Serum (NGS) and incubated overnight with the following primary antibodies in 5% NGS overnight at 4°C: rabbit anti-GFAP (DAKO; #Z0334;1:1000), rat anti-L1-CAM (Millipore ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the plasma was diluted 4:1 with Buffer A for Multiple Affinity Removal LC Columns (Agilent Technologies) and filtered through a 0.22 μm hydrophilic PVDF membrane filter plate (Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then incubated overnight at +4 °C with the 6F3D anti-Aβ antibody (Dako, 1/200), polyclonal anti-tau antibody (Dako ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C with anti-total tau primary antibody solution (1: 5000, DAKO A0024). After 1 hour incubation at RT in the corresponding secondary antibody solution (donkey anti-rabbit 800) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Unstained 4-m thick sections were labeled with H&E or anti-CD79a (1:2000, Dako M7050) and anti-CD56 (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The 1-O-methyl-glycoside TMS derivatives and the PMAAs were analysed by GC-MS (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... and electroporated in 5 separate cuvettes containing 4 µL of the plasmid and 40 µL of ElectroTen-Blue electrocompetent cells (Agilent Santa Clara, CA). After a 1 hour outgrowth in LB at 37C ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Immunology 2020Quote: ... FCCP [carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (1.5 μM) and Rotenone/Antimycin A (1 μM) (purchased from Agilent Technologies) were injected ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived explant tissue sections were stained for cytokeratin (DAKO, Cat. M3515; 1:100 overnight at 4°C), α-smooth muscle actin (αSMA ...
-
bioRxiv - Immunology 2023Quote: ... Antigens were tetramerized by incubation at a >4:1 ratio of biotinylated protein with streptavidin-PE (Agilent; PJRS25) or streptavidin-APC (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 4×105 treated NK cells were resuspended in Seahorse XF DMEM Medium containing glutamine (1 mM; Agilent, USA) and seeded into an 8-well XF cell culture microplate (Agilent ...