Labshake search
Citations for Agilent :
51 - 100 of 2451 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Bioengineering 2024Quote: ... Fatty acids from each fraction were analyzed as their methyl esters after a direct transesterification with acetyl chloride/methanol on a 7890B gas chromatograph coupled to a 5977A Mass Selective Detector (Agilent Technologies, USA) equipped with a capillary column (J&W Select FAME CP7420 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Cell Biology 2022Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Microbiology 2024Quote: ... or flurometric (citrate, acetyl-CoA) assays (cat. no. KA1674, ab102516, KA3791 and MAK039, respectively) and a microplate reader (BioTek Synergy Neo2, Agilent, Santa Clara, CA) according to manufacturer’s instructions (Abnova ...
-
bioRxiv - Immunology 2024Quote: ... Hepta-N-acetyl Chitoheptaose (Cat. no.# 57/11-0010) were analyzed with TSK-Gel (Cat. no.# G2000SWx.) on HPLC (Agilent Technologies 1260 Infinity). The change in refractive index was observed over time for different samples ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Immunology 2024Quote: ... and 2-3 x 105 NK cells per well were seeded in triplicates in Seahorse XF RPMI medium (Agilent, 103576-100) supplemented with 2 mM L-glutamine (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Microbiology 2021Quote: Headspace CO concentrations were monitored every 2-4 days using an Agilent 6890N gas chromatograph (GC; Agilent Technologies, California, US) equipped with a nickel catalyst methaniser (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples were incubated for 2 h at 4℃ in a guinea pig anti-insulin antibody (1:200, A0564, Dako), a rabbit anti-somatostatin antibody (1:500 ...
-
bioRxiv - Biophysics 2020Quote: ... They were then stained for 5 min with 4,6-diamidino-2-phenylindole (DAPI) and mounted using fluorescence mounting medium (DAKO, Agilent). Pictures were taken with an UltraVIEW ERS spinning disk confocal microscope (Zeiss 63X/1.4 ...
-
bioRxiv - Biophysics 2024Quote: ... in xylene and deposited with a 12 μm inter-fiber spacing on top of large diameter (2 μm) support fibers prepared from 5 wt% solutions of polystyrene (MW: 15,000,000 g/mol, Agilent Technologies) dissolved in xylene ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were washed 2 x 5 min in PBS-T and incubated with streptavidin–horseradish peroxidase complex (DakoCytomation). Following 2 x 5 min washes in PBS-T ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were centrifuged at 20.800 xg for 2 min and 100 µl sample was injected on a SEC-HPLC column (Bio SEC-3 300 Å, Agilent, USA) using an Agilent 1260 Infinity II system (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked using 10% Normal Goat Serum (NGS) and incubated overnight with the following primary antibodies in 5% NGS overnight at 4°C: rabbit anti-GFAP (DAKO; #Z0334;1:1000), rat anti-L1-CAM (Millipore ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Genetics 2021Quote: ... Samples with a 260/280 nm absorbance ratio > 1.8 and a 260/230 nm absorbance ratio > 2 were labeled and hybridized to the Tomato Gene Expression Microarray 4 × 44K (Agilent Technologies) as previously described (Coppola et al. ...