Labshake search
Citations for Agilent :
51 - 100 of 419 citations for 3 3 Bromomethyl phenyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Cell Biology 2022Quote: ... grown cells were blocked with 1x PBS containing 3% goat serum (DAKO) for 30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Biochemistry 2023Quote: ... The free HSF2BP protein was analyzed using a BIOSEC 3 column (Agilent) equilibrated in 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA expression was measured using SYBR green on a QuantStudio 3 (Agilent). Probes were generated using NCBI primer blast and are listed in Table X ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... The antigen retrieval was achieved with 3 min proteinase K treatment (S3020, Agilent), and the sections were washed in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... both packed with Polaris C18-A 3-μm material (all from Agilent Corp.). After injection of the sample onto the trapping column ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... Agilent SEC-3 300-Å HPLC column (Agilent Technologies, cat. no. 5190-2511) was used to purify tRNA from total RNA with a temperature-controlled column compartment at 40 °C with 100 mM ammonium acetate aqueous phase at a flow rate of 1 ml/min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and all antibodies (Supplemental Table 3) diluted in antibody diluent solution (DAKO, S0809). Secondary staining was performed for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry the antibodies detailed in follow were used: AE1/3 (Dako/IR053), TTF-1 (Dako/IR056) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For separation a Zorbax RRHD Eclipse XDB C18 column (1.8µm, 3×50mm; Agilent) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Biochemistry 2024Quote: ... The column used was Bio-SEC-3 130 Å 4.6/300 (Agilent Technologies). All samples were run in 20 mM HEPES ...
-
bioRxiv - Microbiology 2024Quote: ... The size exclusion analytical column (Bio-SEC-3, Agilent, Santa Clara, CA, USA) was loaded with 50-µl of protein at a concentration of 3.0 mg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: 3 µm thin TMA sections were mounted on Flex microscope slides (Agilent Technologies) and dried at room temperature (RT ...
-
bioRxiv - Immunology 2024Quote: ... with a guard column Zorbax Extend C18 (3 × 5mm, 1.8μm; Agilent, Waldbronn, Germany), both maintained at 60°C ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Biochemistry 2021Quote: pGEX4T-3 expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Protein expression was induced at 20°C for 3.5 hr ...
-
bioRxiv - Genetics 2021Quote: ... Products were visualized on a 3% TAE agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The purified S protein was separated by an SEC column (BioSEC-3, Agilent, USA) connected to an HPLC system (Analytical HPLC 1260 LC system ...
-
bioRxiv - Cancer Biology 2023Quote: ... Endogenous peroxidase activity was blocked with 3 % hydrogen peroxidase solution (Dako, S2023, CA, USA) for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... or on a Poroshell 120 EC-C18 (Agilent, 3 x 150 mm, 2.7 µm) reversed phase column ...