Labshake search
Citations for Agilent :
51 - 100 of 3859 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... turbidity was monitored in 2-minute intervals at 600 nm absorption using a Cytation 3 plate reader (BioTek, Agilent Technologies, Santa Barbara, CA, USA) preheated to 37 °C and after equilibrating for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Biophysics 2020Quote: ... Optical absorption spectra of the samples in a 300-900 nm range were recorded within about 10 s at given time intervals (about 0.3-1.0 min) in a 3 mL quartz cuvette (Helma QS1000, 1 cm pathlength) using a Cary 60 spectrometer (Agilent). Alternatively ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... flowing 2 mM NH4CHO2 (Solvent A) and ACN (Solvent B) at 15 µL/min through a Zorbax SB-C18 column (Agilent, 0.5 x 150 mm, 3 µm). Quantitation was done monitoring MS/MS transitions m/z 242.1 [M + H]+ → m/z 126.1 [M – deoxyribose + H]+ for 5mC ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA concentration was measured by Nanodrop and 1 to 3 μg of RNA was reverse transcribed with AffinityScript Multi-Temp RT (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subjected to antigen retrieval antigen retrieval (pH = 6.0 for cleaved caspase-3 and pH = 9.0 for cleaved PARP-1) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... free floating sections were blocked with 3% donkey serum and incubated overnight with either rabbit anti-GFAP (1:10000, Dako), rat anti-CD68 (1:200 ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...