Labshake search
Citations for Agilent :
51 - 100 of 3851 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was incubated with horseradish peroxidase-conjugated streptavidin (P0397; Dako; 1:3000, 3% BSA) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL was mixed with 3 µL D1000 sample buffer (Agilent Technologies, cat # 5190-6502) and run on Agilent 4200 TapeStation platform with D1000 screenTape (Agilent Technologies ...
-
bioRxiv - Immunology 2024Quote: ... then in 3% hydrogen peroxide for 15min and in serum-free protein block solution (Dako, Cat # X090930-2) for 30min ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2022Quote: ... grown cells were blocked with 1x PBS containing 3% goat serum (DAKO) for 30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA expression was measured using SYBR green on a QuantStudio 3 (Agilent). Probes were generated using NCBI primer blast and are listed in Table X ...
-
bioRxiv - Biochemistry 2023Quote: ... The free HSF2BP protein was analyzed using a BIOSEC 3 column (Agilent) equilibrated in 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2024Quote: ... and 2-3 x 105 NK cells per well were seeded in triplicates in Seahorse XF RPMI medium (Agilent, 103576-100) supplemented with 2 mM L-glutamine (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The antigen retrieval was achieved with 3 min proteinase K treatment (S3020, Agilent), and the sections were washed in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... both packed with Polaris C18-A 3-μm material (all from Agilent Corp.). After injection of the sample onto the trapping column ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... Agilent SEC-3 300-Å HPLC column (Agilent Technologies, cat. no. 5190-2511) was used to purify tRNA from total RNA with a temperature-controlled column compartment at 40 °C with 100 mM ammonium acetate aqueous phase at a flow rate of 1 ml/min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and all antibodies (Supplemental Table 3) diluted in antibody diluent solution (DAKO, S0809). Secondary staining was performed for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry the antibodies detailed in follow were used: AE1/3 (Dako/IR053), TTF-1 (Dako/IR056) ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For separation a Zorbax RRHD Eclipse XDB C18 column (1.8µm, 3×50mm; Agilent) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... The column used was Bio-SEC-3 130 Å 4.6/300 (Agilent Technologies). All samples were run in 20 mM HEPES ...