Labshake search
Citations for Agilent :
901 - 950 of 8383 citations for Human Uromodulin Like 1 UMODL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Biolegend, 829401, 1:1500 and Dako, Z0334, 1:1500), Nestin (Aveslabs ...
-
bioRxiv - Immunology 2023Quote: ... stained for H&E and HSV-1 (1:1000, Dako), and analyzed by a veterinary pathologist (Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... thyroid transcription factor (TTF-1) (mouse, M3575, 1:100; Dako), and p40 (rabbit ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated with the required primary antibody (ABri: 338 1:1000 from Ghiso lab; ADan: 5282 1:1000 from Ghiso lab; CD68: 1:150 DAKO; CR3/43: 1:100 DAKO) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Genomics 2019Quote: All libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and checked for fragment size using the TapeStation D1000 kit (Agilent). The libraries were pooled in equimolar concentration for a total pooled concentration of 2nM ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using Illumina NovaSeq flowcell with 100 bp single-end runs.
-
bioRxiv - Neuroscience 2022Quote: ... cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen) and a qPCR add-on kit after which they were run on a Fragment Analyzer (Agilent), equimolar pooled and sequenced using an Illumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using Illumina NovaSeq flow cell with 100bp single-end runs.
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... RNA concentration and quality was measured using Agilent RNA 6000 Nano Kit and RNA 6000 Pico Kit (5067-1511 & 5067-1513, Agilent) on Agilent 2100 Bioanalyzer (Fig ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using the Illumina NovaSeq with 100 bp single-end runs.
-
bioRxiv - Molecular Biology 2023Quote: cDNA libraries were generated from RNA samples by using Kapa RNA HyperPrep Kit with RiboErase kit with quality assessed by Agilent High Sensitivity D1000 ScreenTape according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using NEBNext Library Quant Kit and libraries sizes were determined using Bioanalyzer High Sensitivity DNA Kit (Agilent). Indexed libraries were pooled and sequenced on an Illumina MiSeq using a MiSeq Reagent Kit v2 (150×150 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Amplified libraries were cleaned using 1x KAPA Pure Beads Libraries were quantified using NEBNext Library Quant Kit and libraries sizes were determined using Bioanalyzer High Sensitivity DNA Kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Final libraries were QCed using the Qubit dsDNA High Sensitivity kit and Bioanalyzer High Sensitivity DNA Kit (#5067-4627, Agilent). Libraries were sequenced at a concentration of 1.8 pM on a NextSeq with a 75 cycle v2 kit (#TG-160-2002 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library concentrations were measured by Qubit DNA HS kit and the fragment distribution was analyzed by the Bioanalyzer DNA HS kit (Agilent). Before sequencing ...
-
bioRxiv - Genomics 2024Quote: ... The DNA amount was quantified by Qubit HS DNA kit and the fragment size was assessed on a 2100 BioAnalyzer using a DNA HS kit (Agilent). Individual libraries for immunoprecipitated DNA and 10% input were dual indexed (NEBNext Multiplex Oligos ...
-
bioRxiv - Neuroscience 2024Quote: ... The RNA integrity number (RIN) was determined for each sample using Bioanalyzer RNA 6000 Nano Kit or Bioanalyzer RNA 6000 Pico Kit (Agilent) (RIN 8.83 ± 0.93 (mean ± s.d.)) ...
-
bioRxiv - Microbiology 2024Quote: DNA and RNA samples were analysed using either the Tapestation (Tapestation D1000 High Sensitivity DNA kit and Tapestation RNA ScreenTape kit, Agilent) or the Bioanalyzer (DNA 12000 kit ...
-
bioRxiv - Neuroscience 2024Quote: ... a G1603A CE-MS adaptor kit and a G1607A CE-electrospray ionization-mass spectrometry (ESI-MS) sprayer kit (Agilent Technologies). The system was controlled using G2201AA ChemStation software v.B.03.01 for CE (Agilent).
-
bioRxiv - Plant Biology 2020Quote: ... A Bioanalyzer 2100 (Agilent, High Sensitivity DNA Kit) was used for library quality control ...
-
bioRxiv - Cancer Biology 2021Quote: ... and using the High Sensitivity dsDNA kit (Agilent) on the Agilent 2100 Bio-Analyzer ...
-
bioRxiv - Microbiology 2020Quote: ... run using the RNA 6000 Pico Kit (Agilent). To evaluate the extent of remaining buffer and DNA contaminations ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell glycolysis Test Kit (Agilent, 103020), was used for the assay ...
-
bioRxiv - Cell Biology 2020Quote: ... An Agilent 2100 BioAnalyzer and DNA1000 kit (Agilent) were used to quantify amplified cDNA and to control the quality of the libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... PTHrP staining was visualized with diaminobenzidine kit (Dako) and conterstained with Mayer’s hematoxylin ...
-
bioRxiv - Cell Biology 2020Quote: ... using QuikChange site-directed mutagenesis kit (#200515, Agilent). U2OS cells were transfected with the plasmids by electroporation ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Agilent High Sensitivity DNA kit (Agilent) and concentration was determined using QuantiFluor ONE ds DNAsystem on Quantus fluorometer (Promega) ...
-
bioRxiv - Developmental Biology 2020Quote: The SureSelect Exome Enrichment kit V7 (Agilent Technologies) was used to enrich exome sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) was used.
-
bioRxiv - Molecular Biology 2021Quote: ... the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) was used.
-
bioRxiv - Molecular Biology 2020Quote: ... Seahorse XF Cell Mito Stress kit (Agilent Technologies) was used according to manufacturer’s instructions and modified for zebrafish purposes as described in previous publications [80–82] ...
-
bioRxiv - Molecular Biology 2019Quote: ... with a High Sensitivity DNA Kit (Agilent Technologies). The majority of samples were sequenced using a MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... using a RNA 6000 Nano Kit (Agilent Technologies), respectively ...