Labshake search
Citations for Agilent :
901 - 950 of 3384 citations for Anti human IgE Conjugated to 40 nm Gold since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... together with 40 ng/μl of a transfection reporter plasmid encoding humanized Renilla GFP (hrGFPII; Stratagene) and 0.01% Fast Green (AppliChem).
-
bioRxiv - Genetics 2024Quote: ... 72 °C 0:40 min) for each independent sample using Herculase polymerase (Agilent, catalog number 600677). The primers used are also listed in Supplementary Table 9 ...
-
bioRxiv - Microbiology 2020Quote: ... coli Lgt fused to a C-terminal Flag-tag was transformed into Rosetta 2(DE3) Gold cells (Agilent). Starter cultures were grown in Terrific Broth (TB ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were then transformed into XL-10 Gold chemically competent Escherichia coli cells (Agilent Technologies, Santa Carla, CA) as previously described [14] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with an eliminated kanamycin-resistance cassette (Supplementary Fig. 4) and XL10-Gold (Agilent Technology, Inc., Santa Clara, CA), were used for cloning and library construction ...
-
bioRxiv - Immunology 2022Quote: ... pooled at 4 nM and quality-assessed on a 2100 Bioanalyzer (Agilent Technologies). Sequencing was performed on an Illumina MiSeq (paired-end ...
-
bioRxiv - Physiology 2023Quote: ... Absorbance at 630 nm was measured using a Synergy H1 spectrophotometer (Agilent BioTek) and converted to amount of medium consumed (µg/fly ...
-
bioRxiv - Microbiology 2023Quote: ... and substrate degradation was measured at 405 nm using Synergy HT (BioTek, Agilent). The experiment was repeated three times for reproducibility.
-
bioRxiv - Molecular Biology 2024Quote: ... Then the supernatant was read at 570 nm (Agilent Cary 60 UV-vis). This wavelength reads the intensity of the pink colour of the reduced product ...
-
bioRxiv - Cell Biology 2024Quote: ... The assay was quantified by spectrophotometry at the absorbance of 540 nm (Agilent BioTek Epoch ...
-
bioRxiv - Cancer Biology 2021Quote: ... Detection was performed using horseradish peroxidase (HRP) conjugated antibodies (DAKO) and developed with Super Signal West Femto Maximum Sensitivity Substrate (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from DAKO.
-
bioRxiv - Cell Biology 2021Quote: ... The corresponding horseradish peroxidase (HRP)-conjugated secondary antibodies (Dako, Denmark), diluted at 1:2500 in PBSTM were added for approx ...
-
bioRxiv - Cell Biology 2021Quote: ... and species corresponding horseradish peroxidase conjugated polyclonal secondary antibodies (DAKO) in blocking solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by DAKO envision+ system horseradish peroxidase (HRP) conjugated secondary antibody (DAKO, #K4003) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... HRP-conjugated goat antimouse IgG was from Dako (Agilent, Singapore).
-
bioRxiv - Cell Biology 2023Quote: ... horseradish peroxidase (HRP) conjugated antibodies from Dako (P0448 and P0447) were used with the dilution specified on the instruction leaflet.
-
bioRxiv - Cancer Biology 2023Quote: ... followed by incubation with HRP-conjugated streptavidin–biotin complex (DAKO). Substrate was developed with DAB (DAKO)and pictures were produced using a Nikon Eclipse E800microscope with a Nikon DXM1200 digital camera (Nikon ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then in horseradish peroxidase (HRP)-conjugated secondary antibodies (Dako) at room temperature for 1 hour and then developed with WesternBright ECL HRP substrate (Advansta) ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated 1h with HRP-conjugated secondary antibodies (DAKO, 1:2000) in 1X TBS-Tween containing 5% non-fat dry milk ...
-
bioRxiv - Molecular Biology 2022Quote: ... Appropriate secondary antibodies conjugated to horseradish peroxidase were used (DAKO).
-
bioRxiv - Neuroscience 2023Quote: ... Protein was visualized with a secondary HRP conjugated antibody (Dako) followed by development with ECL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... Appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2,000, Agilent Dako ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by HRP-conjugated secondary antibodies (Dako, P0448 and P0447).
-
bioRxiv - Cancer Biology 2022Quote: ... Immunohistochemistry (IHC) for human CD45 antibodies (IR75161-2, Agilent Technologies) was performed on FFPE blocks of engrafted tumors to identify cases of lymphomagenesis ...
-
bioRxiv - Immunology 2021Quote: ... Samples were analyzed against the Stratagene Universal Human Reference (Agilent). Raw fluorescence intensities were quantified and normalized (Lowess normalization ...
-
bioRxiv - Cancer Biology 2020Quote: ... whole Human Genome 44 K arrays (Agilent Technologies, product G4112A) were used for stroma and epithelial expression profiles ...
-
bioRxiv - Genetics 2022Quote: ... including A sample (Universal Human Reference RNA, Agilent Technologies, Inc.) and B sample (Human Brain Reference RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Agilent SureSelect Human All Exon v6 kit (Agilent Technologies) was used for whole exome sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293AD human embryonic cells (#240085, Agilent, Santa Clara, California, USA) and PC3 prostate cancer cells (#CRL-1435 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and for human Vimentin (1:4,000; M0725; DakoCytomation; Glostrup, Denmark), P-gp (1:200 ...
-
bioRxiv - Bioengineering 2022Quote: ... the solution was diluted to 40 mL in water/acetonitrile and purified using reverse-phase HPLC (Agilent Zorbax SB C3 column ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antigen retrieval consisted of steaming for 40 min in Target Retrieval Solution (S1700, Agilent, Santa Clara, CA). Slides were then washed and equilibrated in TBS-Tween buffer (Sigma ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected and filtered with Captiva EMR cartridges (40 mg, 1 mL; Agilent Technologies, Australia) to remove the lipid fraction using a positive pressure manifold (Agilent PPM48 Processor ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced through site-directed mutagenesis (QuikChange II XL, with 10 XL Gold cells; Agilent Technologies, Kista, Sweden) and confirmed by sequencing at the Linköping University Core Facility.
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei staining with Hoechst (1:10.000 in PBS) applied between initial washes or with ProLong Gold DAPI mounting medium (Dako). Micrographs were recorded using a Zeiss LSM710 point laser (Argon Lasos RMC781272 ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fragments were joined by Gibson assembly and used to transform chemically competent BL21-Gold(DE3) cells (Agilent Technologies). Individual clones were sequence-verified by Sanger sequencing (Microsynth AG) ...
-
bioRxiv - Cell Biology 2023Quote: ... NEBuilder HiFi DNA Assembly Master Mix was used to assemble the inserts and backbones according to the manufacturer’s protocol and transformed into XL10-Gold competent cells (Agilent). Bacteria containing the constructs were then grown overnight at 37°C and the DNA was extracted using the Zyppy Plasmid Miniprep Kit (Zymo Research ...
-
bioRxiv - Immunology 2024Quote: ... Four to eight clones of each sample were picked from transformed XL10 gold ultra-competent cells (Agilent Technologies, USA), incubated in 5 ml at 37°C overnight in LB (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... a UV detector (1100 series, 280 nm; Agilent Technologies In., Santa Clara, CA, USA) and a differential refractive index detector (Optilab rEX ...
-
bioRxiv - Immunology 2021Quote: ... mouse thymocytes were exposed to 254 nm UV-irradiation for 6 minutes (Stratagene Stratalinker) followed by labelling with 2 μM CFSE (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... The absorbance was taken at 450 nm using the Epoch Plate Reader (Agilent BioTek).
-
bioRxiv - Neuroscience 2023Quote: ... absorbance was measured at 570 nm with a BioTek Epoch microplate spectrophotometer (Agilent Technologies). For the fluorometric test ...
-
bioRxiv - Neuroscience 2023Quote: ... the absorbance was measured at 450 nm using a Synergy HT microplate reader (Agilent) and normalized by the protein content of each sample ((ng/ml)/μg of protein).
-
bioRxiv - Cell Biology 2023Quote: ... The absorbance was measured at 515 nm in a BioTek Epoch Microplate Spectrophotometer (Agilent). ARSA and ARSB units are defined as the amount of 4-nitrocatechol liberated in 1 hr per mg of total protein ...
-
bioRxiv - Physiology 2023Quote: ... The 540 nm absorbance was measured using a Synergy H1 plate reader (Agilent BioTek), and glycogen levels were calculated based on a glucose standard curve after subtracting the absorbance measured for free glucose in the untreated samples from the absorbance of the samples digested with amyloglucosidase ...
-
bioRxiv - Physiology 2023Quote: ... Absorbance at 492 nm was measured using a plate reader (Synergy H1, Agilent BioTek). The TAG content was determined by subtracting free glycerol from TAG ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mM ADP and 1 nM plasma membrane permeabilizer (Agilent Technologies, Cat #102504-100). Cells were incubated for 20 minutes in MAS ...
-
bioRxiv - Neuroscience 2024Quote: Harvested mouse brain tissues were UV crosslinked at 254 nm with a stratalinker (Stratagene) two times to achieve a 4,500 J/m2 UV flux and flash-frozen in liquid nitrogen ...