Labshake search
Citations for Agilent :
901 - 950 of 4022 citations for 8 Chloro 4 methyl 1 2 dihydroquinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Residual CP and its metabolite 3,5,6-trichloro-2-pyridino (TCP) was quantified using a reverse-phase C18 column (ZORBAX Eclipse Plus, Agilent Technologies, USA) fitted with Agilent Technologies 1260 Infinity HPLC system equipped with a binary pump ...
-
bioRxiv - Biochemistry 2022Quote: ... CaCl2 was added to a final concentration of 2 mM and the supernatant was added to a disposable column containing 400 μL calmodulin resin (Agilent) pre-equilibrated with E buffer and 2 mM CaCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... or SARS-CoV-2 nucleocapsid (EY-2A, a kind gift from Prof Alain Townsend) primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). Chemiluminescence substrate (West Dura ...
-
bioRxiv - Microbiology 2020Quote: ... DNA removal was confirmed by PCR using primers OL398 and OL399 (Table 2) and RNA quality was assessed using an Agilent 2100 Bioanalyzer system with corresponding RNA 6000 Nano kit (Agilent) to confirm RNA integrity (RIN) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting DNA fragments were cloned in frame with the FLAG tag using the oligonucleotides that are indicated in Supplementary file 2 into the pESC-URA vector (Agilent), in which the GAL10 and GAL1 promoters were replaced with the Cup1 promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 384-well plates on 5 μL scale reactions using 2 μL diluted cDNAs and Brilliant III Ultra-fast SYBR Green qPCR Master Mix (Agilent) with primers listed in Table S7 at a final concentration of 0.4 μM ...
-
bioRxiv - Immunology 2022Quote: ... viral protein in the virus-infected cells was detected by ELISA assay using anti-SARS-CoV-2 nucleocapsid mAb (40143-R001, SinoBiological) and HRP-conjugated goat anti-rabbit pAb (P0448, Dako). After 10 min incubation with TMB substrate ...
-
bioRxiv - Immunology 2022Quote: ... The negative control used was the Rabbit FLEX Universal Negative Control (cat. no. IR60066-2, Agilent, Santa Clara, CA, USA). Images were scanned using the Brightfield setting of the Vectra Polaris Multispectral Imaging System.
-
bioRxiv - Genomics 2022Quote: ... Arrays were read using an Agilent scanner at 2 μm resolution and the signal segmentation was done using the feature extraction software (Agilent). The data was normalized without background subtraction using the global Lowess method (74).
-
bioRxiv - Neuroscience 2022Quote: ... Then 25 μl of the supernatant was transferred into a 2 ml sample vial containing a 250 μl deactivated glass insert (5181-8872, Agilent). 40 μl of N-Methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA ...
-
bioRxiv - Cell Biology 2022Quote: ... yeast cells were preinoculated in selective medium and the next day an OD600 of 0.01 was inoculated in YNB medium and growth was monitored every 2 h in spectrophotometer (Cary 60 UV-Vis, Agilent). Yeast cells were transformed using a standard lithium acetate transformation protocol (Gietz and Woods ...
-
bioRxiv - Biochemistry 2019Quote: ... The quality of the RNA was assessed by Nanodrop spectrophotometry (A260/A280 ratio ~2) and fragment analysis using a Bioanalyzer (Agilent). RNA quality numbers (RQNs ...
-
bioRxiv - Evolutionary Biology 2019Quote: We prepared exome capture libraries on the selected African samples and on all the successfully amplified Omani samples using the pre-capture pooling method of the SureSelect 2 XT Target Enrichment System (Agilent) (64) ...
-
bioRxiv - Neuroscience 2019Quote: ... or Linker 2 (between Kv3.1 and miRFP670) were generated either by overlap extension PCR or using site-directed mutagenesis (QuickChange, Agilent, USA). Plasmid pPuro-CAG-CheRiff-IRES-NLS-mTagBFP2 encoding the optogenetic activating opsin CheRiff was made by subcloning CheRiff ...
-
bioRxiv - Immunology 2019Quote: ... Samples were resuspended in water and 2 μL of each sample was analyzed on our LC-DMS/MS system (Agilent 1290 UPLC in tandem with Sciex 6500+ equipped with a DMS frontend) ...
-
bioRxiv - Genomics 2019Quote: ... Amplicons were isolated on a 2% TAE agarose gel and bands were confirmed using Agilent’s D1000 ScreenTape and reagents (Agilent Technologies) on a 2200 Tapestation system ...
-
bioRxiv - Neuroscience 2019Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... OCR and ECAR was determined in standard Seahorse medium on day three after seeding before and after injection of 2 µM oligomycin on a XF24 analyzer (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: 100 μL of purified recombinant protein (at approximately 2 mg/mL) were loaded onto a sizeexclusion chromatography column (PL1580-3301, Agilent) in the phosphate buffer (20 mM Tris ...
-
bioRxiv - Neuroscience 2019Quote: ... Peptides were trapped on an in house made trap column (Dr Maisch Reprosil C18 column, 3 µm, 2 cm x 100 µm) and separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2019Quote: ... Mutation of glycine at position 2 to alanine was accomplished using the Quick-Change Mutagenesis kit (Agilent, Santa Clara, CA) to generate ptubTgFBXO1HAG2A.
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Microbiology 2021Quote: ... D950N) were prepared from wild-type SARS-CoV-2 spike using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent). Additional RBD mutations were introduced into the Delta spike also using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... The size of the amplicon was confirmed by analyzing 2 μl of PCR products using the Agilent D5000 ScreenTape System (Agilent D5000 ScreenTape ...
-
bioRxiv - Biochemistry 2021Quote: About 2 µg of obtained total RNA was immediately used for cDNA formation using AccuScript High Fidelity cDNA Synthesis Kit (Agilent). RT-qPCR was performed in a 96-well plate on a CFX96 qPCR system (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were transferred into 2 mL LC/MS glass vials for the LC-MS/MS analysis by using an UHPLC system (Agilent Technologies 1290 with a UPLC BEH Amide column ...
-
bioRxiv - Genetics 2019Quote: ... 0.3 mL of the organic layer (the lower chloroform layer) was collected into a 2 mL amber glass vial (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Immunology 2021Quote: ... Epitope retrieval was performed at 97C for 10 min with the Dako Target Retrieval Solution pH 9 (Agilent, S236784-2) on a Lab Vision PT Module (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2021Quote: ... the initial concentrations of purified SARS-CoV-2 and the universal human reference RNA (UHRR, Agilent Technologies, product number 740000) were determined by ddPCR as described above ...
-
bioRxiv - Cell Biology 2021Quote: ... The jordan and shaker-2 non-synonymous substitutions were separately introduced into pFastbac1 M15-2IQ-EGFP-FLAG by site-directed mutagenesis (QuikChange II, Agilent) and verified by Sanger sequencing ...
-
bioRxiv - Immunology 2022Quote: ... 50 µL of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2% FBS was added to each well of a 96-well E-plate (Agilent) to establish the background reading ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Isolated genomic DNA was sheared to a mean size distribution of 20 kb using a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and fragment size was confirmed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Microbiology 2022Quote: The tandem mass spectrometer was hyphenated to a liquid chromatography set-up comprising 2 binary pumps (1290 series, Agilent technologies). For each experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... live cell imaging lines were generated using a U-2 OS cell line harboring a Flp-In site and stably expressing a ponasterone A inducible system (Agilent), a gift from Robert Singer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated viral (AAV) vector serotype 2 was prepared using an AAV Helper-Free system (Agilent Technologies, Santa Clara, CA) as described previously (Kato et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the integrity and size distribution of the RNA was assessed using mRNA Nano series 2 assay (G2938, Agilent Technologies).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...