Labshake search
Citations for Agilent :
901 - 950 of 1510 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Neuroscience 2019Quote: ... Incubation with the primary antibody was done overnight at 4°C and with secondary antibodies (DAKO #P0217, #P0260) for 1.5 hours at RT with washing in TBS-Tween trice for 15 minutes each after each incubation ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The column was Poroshell 120 EC-C18 (150 mm × 4.6 mm, 100Å, particle size 4 μm; Agilent Technologies). The injection volume was 10 μL ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1 μM (OMM2.3) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 μM of a rotenone antimycin A mix (Agilent). Following the assay ...
-
bioRxiv - Cancer Biology 2019Quote: ... Slides were incubated at 4°C overnight and then washed and visualized with DAB+ substrate chromogen (Agilent Technologies). The patient groups with 249T-P positive and negative were divided at 10% cutoff value.
-
bioRxiv - Immunology 2020Quote: ... FCCP [carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (1.5 μM) and Rotenone/Antimycin A (1 μM) (purchased from Agilent Technologies) were injected ...
-
bioRxiv - Developmental Biology 2021Quote: ... then at 4°C overnight with primary antibodies diluted in Dako REAL Antibody Diluent (Agilent, Santa Clara, CA). We used the following primary antibodies ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived explant tissue sections were stained for cytokeratin (DAKO, Cat. M3515; 1:100 overnight at 4°C), α-smooth muscle actin (αSMA ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were then incubated overnight at 4 °C with appropriate dilution of anti-Ki67 (1:100, Dako, M7240) in TBS containing Horse Serum (2%) ...
-
bioRxiv - Immunology 2023Quote: ... Antigens were tetramerized by incubation at a >4:1 ratio of biotinylated protein with streptavidin-PE (Agilent; PJRS25) or streptavidin-APC (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded at 4×104 cells per well in Seahorse XF24 tissue culture plates (Seahorse Bioscience Europe). The sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... The m6A level was then determined using a Synergy 4 automatic microplate reader (Agilent BioTek; Winooski, VT, USA) at 450 nm.
-
bioRxiv - Genomics 2023Quote: ... which brought the total number of DNA probes to 174,550 spots for a 4×180k microarray (Agilent Technologies). Additional spots on the array were set aside for control grid alignment ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with an eliminated kanamycin-resistance cassette (Supplementary Fig. 4) and XL10-Gold (Agilent Technology, Inc., Santa Clara, CA), were used for cloning and library construction ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary incubation was performed overnight at 4°C (phospho-Ser129, BioLegend Cat # 825701, 1:2000; GFAP, DAKO Cat # GA524 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded at 4 x 104 cells per well in XFe24 cell culture microplates (Agilent, 102340-100) in 10 ml of DMEM [high glucose DMEM with pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Immunology 2019Quote: ... RP1-5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3’ and RPI1-5’-CAA GCA GAA GAC GGC ATA CGA GAT CGT GAT GTG ACT GGA GTT CCT TGG CAC CCG AGA ATT CCA-3’ and the purified library was quantified with 4200 TapeStation (Agilent Technologies) and paired-end sequenced on a Nextseq 500 V2 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... The PAM sequences in the c(3)G gene were mutated using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology). The bases changed are in bold above ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted cells by the centrifugation for 3 min at 300 rcf are stained with FITC-conjugated anti-lysozyme antibody (Dako, F0372) and APC-conjugated anti-CD24 antibody (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: Measurements in both settings were performed in 3 min mix and 3 min measure cycles at 37 °C in six replicates per condition on a Seahorse XFe96 Analyzer (Agilent Technologies). OCR and ECAR were depicted as pmol/min and mpH/min ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 µm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15 ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Immunology 2021Quote: ... HES5 and GATA6 genes were made for 3 replicates using the Brilliant III Ultra-Fast SYBR green qPCR master mix (Agilent Technologies) and analyzed on a CFX Opus Real-Time PCR system (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Biophysics 2021Quote: ... then was injected to online SEC-SAXS equipped with a temperature-controlled (15 °C) silica-based SEC column (Agilent BioSEC-3)32 ...
-
bioRxiv - Cancer Biology 2022Quote: ... heat mediated antigen retrieval was performed for 3 min at 125°C in citrate pH 6.0 target retrieval solution (Dako Cat# S2369) using a decloaking chamber (Biocare Medical) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were read at 450 nm and 560 nm wavelengths using a BioTek Cytation 3 Cell Imaging Multi-Mode Microplate Reader (Agilent Technologies). Plasma samples isolated from retroorbital bleeds were used for ProcartaPlex immunoassays (Thermo Fisher ...
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...