Labshake search
Citations for Agilent :
901 - 950 of 6558 citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA 6000 Nano Kit (Agilent). RNA integrity was preserved ...
-
bioRxiv - Cell Biology 2023Quote: ... and High sensitivity DNA kit (Agilent) and quantity with the Collibri Library Quantification kit (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2023Quote: ... and final size determined by Agilent DNA 1000 Kit (Agilent, #5067-1504) on the Agilent Bioanalyzer.
-
bioRxiv - Neuroscience 2021Quote: ... For ChR2-mediated optogenetic stimulation, blue light (473 nm, 6 Hz or 20 Hz) was produced using an arbitrary waveform generator (Agilent, 33220A) and a diode-pumped solid-state laser (Laserglow ...
-
bioRxiv - Genomics 2020Quote: ... and the presence of >20 kbp fragments were validated using the FEMTO Pulse automated pulsed-field capillary electrophoresis instrument (Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Product formation was monitored over 20 minutes via absorbance at 420 nm using a Varian Cary® 50 UV-Vis Spectrophotometer (Agilent).
-
bioRxiv - Biophysics 2022Quote: ... The samples were loaded on a Superdex 200 10/300 Increase column (Cytiva) at a temperature of 20°C run by a 1260 Infinity II HPLC (Agilent Technologies) at 0.6 ml/min ...
-
bioRxiv - Cell Biology 2022Quote: ... Arrays were then washed with probing buffer (0.1% Tween 20, 1% BSA, 10% PBS) and incubated for 1.5 h in a hybridization chamber (Agilent, Santa Clara, CA) in a reaction mixture containing 80 μg of purified His-SETD6 in probing buffer in a total reaction volume of 950 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... and the membrane was blocked with 5% milk in tris-buffered saline with Tween 20 (TBST) before immunodetection with the following primary antibodies: tau (1:1000, DAKO, Denmark), pTau-S396 (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Slides were then washed twice with wash buffer before a 20-minute incubation with Envision FLEX HRP Polymer (GV823, Agilent DAKO) for HRP binding ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μm paraffin-embedded tissue sections were either dewaxed and subjected to antigen retrieval treatment with Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent) or dewaxed as part of the antigen retrieval process using the Low pH EnVision ™ FLEX Target Retrieval Solutions (K8005 ...
-
bioRxiv - Neuroscience 2021Quote: Paraffin-embedded sections were deparaffinized and autoclaved at 121°C for 20 min in Target Retrieval Solution (Dako Japan Inc., S1700). Frozen sections were briefly washed in PBS and incubated with 0.5 % SDS (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... A total amount of 5 μg from each sample (volume of 20 μl) was loaded into the chromatographic system consisting in a C18 pre-concentration cartridge (Agilent Technologies) connected to a 360 cm long ...
-
bioRxiv - Cell Biology 2020Quote: ... Prior to immunohistochemistry antigen retrieval was performed using Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent). Quenching of endogenous peroxidase was performed by a 10 min incubation with Peroxidase-Blocking Solution (Dako REAL S2023) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then treated with envision FLEX/HRP reagent for 20 min and then washed and stained by the envision FLEX-DAB chromogen (cat No. DM827, Dako, Denmark) and by Mayer’s Hematoxylin (Lille’s Modification ...
-
bioRxiv - Microbiology 2019Quote: ... The dried FAME samples were dissolved in 20 μL dichloromethane and analysed by injection of 1 μL into a GC-MS (GC-6890N, MS detector-5973; Agilent Technologies) using a ZB-5 column (30 m × 25 mm × 25 mm ...
-
bioRxiv - Plant Biology 2019Quote: ... 60 °C for 20 s and 72 °C for 15 s (Clontech SYBR Green Master Mix and Mx3000P qPCR Systems, Agilent Technologies). Primers for circadian clock genes were designed using pcrEfficiency (Mallona et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR was performed with 5 μl of 20x-diluted cDNA and a primer concentration of 1 μM in a 20 μl reaction with Brilliant III Ultra-Fast SYBR GREEN Master Mix (Agilent, www.agilent.com) with a BioRad CFX Connect thermocycler (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... membranes were washed with 0.1% Tween-20 in PBS and incubated with anti-mouse or anti-human IgG (1:5000; Agilent Dako, Glostrup, Denmark), conjugated to horseradish peroxidase ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sections were washed in TBS and Tween-20 and stained for 1 hour with HRP-labelled secondary antibody (Dako K4003). The staining was developed with diaminobenzidine (DAB ...
-
bioRxiv - Microbiology 2022Quote: ... the gentamicin resistance marker (PflaB-aaC1) was amplified from pMH105 (20) by PCR and then TA-cloned into pSC-A-amp/kan (Agilent Technologies). Following confirmation of the TA clones ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were subsequently rinsed with PBS supplemented with 0.01% Tween 20 and probed with horseradish peroxidase-labelled rabbit anti-mouse immunoglobulins (1 in 500 dilution) (DAKO, Agilent Technologies) for 40 min ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Plant Biology 2022Quote: ... Powdered samples (1 g) were weighed and transferred immediately to a 20 mL head-space vial (Agilent, Palo Alto, CA, USA), containing NaCl saturated solution to inhibit potential enzyme reactions ...
-
bioRxiv - Physiology 2022Quote: ... sections were dewaxed and epitope retrieval was performed using Citrate buffer pH6 for α-SMA and Ter119 or Tris- EDTA buffer pH9 for HMOX1 in all cases for 20 min at 97°C using a PT Link (Dako, Agilent) or with ER2 buffer (AR9640 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Heat-induced epitope retrieval (HIER) was performed by immersing the tissue sections at 98°C for 20 minutes in LowFlex (Dako #K8005). Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The qPCR was performed in 20 μl SYBR Green reaction mixture using a Real-time PCR system (Agilent AriaMx Real-time PCR System, Agilent, USA). The ChIP experiments and qPCR were performed in triplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample pH was then adjusted to 4 with 15 μL of 20% formic acid before loading onto conditioned SPE Bond-Elute pH columns (Agilent, 14102062) at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 mg (1 mL) of sample powder was transferred immediately into a 20-mL headspace vial (Agilent, Palo Alto, CA, USA) that contained an NaCl-saturated solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... together with 20 μl of pre-washed Protein A/G Dynabeads Chromatin digestion was assessed using TapeStation electrophoresis system (Agilent Technologies). Desired DNA digestion yielded a mono- and poly-nucleosome pattern with a range of DNA fragments 100-1000 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... The aqueous samples were resuspended in 35x the packed cell volume using 80:20 methanol:water and transferred to polypropylene mass spectrometry vials (Agilent, 5188-2788).
-
bioRxiv - Cancer Biology 2023Quote: ... The aqueous samples were resuspended in 35X the tissue mass (mg) of 80:20 methanol:water and transferred to polypropylene mass spectrometry vials (Agilent 5188-2788).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed thrice with 0.1% (v/v) tween-20 / PBS and incubated in Serum Free Protein Block (DAKO, cat.#X0909) for 1h at 21°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... pET30a-AlkB-D135S/L118V (20) was constructed by performing site directed mutagenesis on pET30a-AlkB-D135S using the QuikChange protocol (Agilent Technologies) and the oligos L118V_FW (GATTTCCAGCCAGATGCTTGTGTTATCAACCGCTACGCTCCT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The extract was purified on an Eclipse XDB-C18 (5 µm, 9.4 mm × 250 mm, Agilent) on an Agilent 1200 HPLC using a linear gradient from 15 to 45% acetonitrile over 42 min with water as the aqueous mobile phase after an initial increase of 0 to 15% acetonitrile over 1.5 min at flow rate of 4 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pooled RNA was quality tested on an ABI2000 bioanalyzer (Agilent Technologies, Sta. Clara, CA), labeled ...
-
bioRxiv - Cell Biology 2019Quote: ... - Kinetex EVO (5 μm, 100 Å)) on a HPLC system (Agilent, LC 1260 Infinity II, Agilent). A two-step gradient was applied ...
-
bioRxiv - Microbiology 2019Quote: ... The obtained BALF was concentrated using 5 kDa cutoff 4 ml spin concentrator (Agilent Technologies, USA) before infectivity experiments.
-
bioRxiv - Genetics 2019Quote: ... washed twice with PBS for 5 minutes and then incubated with anti-rabbit biotinylated antibody (Dako) at a concentration of 1:500 in PBS for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... Hybridized arrays were scanned at 5 μm resolution on a Microarray Scanner (Agilent p/n G2565BA). Data extraction from images was done by using Agilent Feature Extraction (FE ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Biochemistry 2021Quote: ... separations were carried out on an AdvanceBio Peptide Map Guard (2.1×5 mm, 2.7μm, Agilent technologies) and AdvanceBio Peptide Map column (2.1×150 mm ...
-
bioRxiv - Biochemistry 2020Quote: ... the peaks separation occurred on Zorbax Eclipse Plus C18 5 µm (4.6×250 mm) column (Agilent) in 0.1 M TEAA buffer system ...
-
bioRxiv - Cancer Biology 2020Quote: ... Following antigen retrieval by autoclaving for 5 min in DAKO antigen retrieval solution (DAKO, Carpenteria, CA) the sections were washed twice in TBS buffer ...
-
bioRxiv - Microbiology 2021Quote: ... equipped with a 5% phenylmethyl silicone capillary column and a mass spectrometer (model 5975C; Agilent Technologies). Helium was used as carrier gas ...
-
bioRxiv - Microbiology 2020Quote: ... equipped with an Eclipse XDB-C18 reverse-phase column (5 μm; 4.6 × 250 mm; Agilent, USA) and an LCQ Deca XP Max MS instrument (Thermo Finnigan ...
-
bioRxiv - Cancer Biology 2021Quote: ... Eluates were desalted using C18 cartridges (5 µL bed volume, Agilent Technologies, cat. no. 5190–6532) on an automated liquid handler as per the manufacturer’s instructions ...