Labshake search
Citations for Agilent :
901 - 950 of 1061 citations for 2 Cyano 2' pyrrolidinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed in TBST and incubated for 1-2 h with the peroxidase-coupled secondary antibody (HRP-coupled anti-rabbit IgG (Dako, #P0448), HRP-coupled anti-mouse IgG (Dako ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Microbiology 2024Quote: ... and optical density at 600 nm was measured every 90 min for a duration of 72 h using a BioTek Epoch 2 microplate reader (Agilent Technologies) connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Immunology 2024Quote: ... The tissue sections were blocked for 30 minutes in 10% normal goat serum.2% BSA in PBS.The primary antibody incubation (rabbit polyclonal GFAP antibody, Dako, cat#Z0334) was used at 1 ug/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... The section was subsequently incubated in primary antibodies (GFAP,1:1000, D1F4Q, Cell Signaling or CD79A, 1:200, M705001-2 DAKO or CD3, 1:100, A0452 DAKO), in BTHP-buffer (1% bovine serum albumin (BSA) ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Pathology 2024Quote: ... followed by treatment with H2O2 for 10 minutes and a rinse with wash buffer. Primary Ab (Suppl. Table 2) were diluted with background reducing components (Dako S3022) and incubated with the tissues overnight at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% water in acetonitrile) followed by a step to 99% B delivered by the 1290 Infinity II LC system (Agilent Technologies) at a flow rate of 40 μL/min ...
-
bioRxiv - Developmental Biology 2024Quote: ... with anti-mouse epitopes visualised with DAB chromogen in brown and anti-rabbit epitopes visualised with alkaline phosphatase in magenta or the Envision kit (mouse/rabbit) (K500711-2, Agilent, UK). Sections were counterstained with haematoxylin or methyl green and coverslipped with permanent mounting medium before imaging.
-
bioRxiv - Immunology 2024Quote: ... and 2-3 x 105 NK cells per well were seeded in triplicates in Seahorse XF RPMI medium (Agilent, 103576-100) supplemented with 2 mM L-glutamine (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... were seeded at 6,000 cells per well in 80 µL of MEM media (MEM 10% FBS + 1% P/S + 1 mM Sodium Pyruvate + 2 mM Glutamax + 1% nonessential amino acids + 50 µg/mL uridine) in a Seahorse 96-well cell culture plate (Agilent, USA). After 24 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... was applied for 30 min at a concentration of 0.108 µg/mL at room temperature using Antibody Diluent (S302283-2, Agilent Technologies Inc). Detection was performed using the Bond Polymer Refine Kit (DS9800 ...
-
bioRxiv - Biochemistry 2024Quote: ... Membranes were washed three times with TBS/T before HRP-coupled secondary antibodies were applied 1:25000 in TBS and incubated for 2 h at RT (Polyclonal rabbit anti-mouse, Dako P0260; polyclonal swine anti-rabbit, Dako P0217). Membranes were washed and chemiluminescence induced with the SuperSignal West Pico PLUS detection reagent kit (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... we measured TopFluor-cholesterol spectra between 490 nm and 550 nm with 2 nm steps using a BioTek Synergy H1 plate reader (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...
-
bioRxiv - Immunology 2021Quote: ... Paraffin sections (4µm thick) of FFPE thymus and lymph node tissues (NMR, mouse, and human control) were stained for cytokeratin (AE1/AE3, Dako GA05361-2) on a Dako Omnis autostainer with pressure cooker antigen retrieval (TrisEDTA ...
-
bioRxiv - Microbiology 2021Quote: ... were acidified with 5 µl of 30% HCl per 2 mL to prevent precipitation and measured by inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent Technologies 5100). Porewater for dissolved inorganic carbon (DIC ...