Labshake search
Citations for Agilent :
851 - 900 of 6679 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Tumor MMR status was determined by immunohistochemical detection of PMS2 (anti-PMS2 antibodies; clone EP51, DAKO) and MSH6 (anti-MSH6 antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... The detection was carried out using Dako EnVision®+ Dual Link System-HRP (DAB+) (Dako, Agilent). The Liquid DAB+ Substrate Chromogen System (Dako ...
-
bioRxiv - Immunology 2023Quote: ... Detection was performed with a secondary Ab conjugated to HRP (Agilent DAKO, Santa Clara, CA, USA) and visualized with tetramethylbenzidine (TMB ...
-
bioRxiv - Immunology 2023Quote: ... Detection was performed with a secondary Ab conjugated to HRP (Agilent DAKO, Santa Clara, CA, USA) and visualized with tetramethylbenzidine (TMB ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by detection using similar protocols published previously(21) with the NovoCyte flow cytometer (Agilent, USA). The iFluor 647 fluorescent intensity was detected with the APC channel ...
-
bioRxiv - Microbiology 2023Quote: ... The detection was carried out using Dako EnVision®+ Dual Link System-HRP (DAB+) (Dako, Agilent). The Liquid DAB+ Substrate Chromogen System (Dako ...
-
bioRxiv - Cancer Biology 2022Quote: Drug detection studies were performed using Accurate Mass-Q-TOF mass spectrometer (Agilent Technologies Inc, USA) equipped with electron spray ion source (ESI) ...
-
bioRxiv - Microbiology 2019Quote: ... Complementation of ΔfimB mutants were performed by cloning the promoter and encoding regions of the parental fimB genes into pSC-A-amp/kan (Table S4) by using the StrataClone PCR Cloning Kit (Agilent Technologies, Massy, France). The recombinant plasmid was then electroporated into competent strains S250ΔfimB: ...
-
bioRxiv - Cell Biology 2020Quote: pSecTagNC + ΔEGF_mN1 W1758A and pSecTagNC + ΔEGF_mN1 R1994A: these plasmids were generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pSecTagNC + ΔEGF_mN1 as a template and primers ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA3 + mNICD R1994A: this plasmid was generated by PCR-based mutagenesis using the QuikChange Lightning Multi Site-Directed mutagenesis kit (Stratagene, Santa Clara, USA) using pcDNA3 + mNICD as a template and the primer A2026VmutF.
-
bioRxiv - Microbiology 2021Quote: ... from the pIdsBB expression system containing a C-terminal GFPmut2 fusion (Gibbs et al., 2008) using error-prone PCR with the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA) and ligated back into the same pIdsBB expression vector using the restriction enzymes SacI and BamHI ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were air-dried at RT for 30 min and a hydrophobic pen (DAKO, Cat# S2002) was used to delineate the border of the slide surface ...
-
bioRxiv - Genomics 2020Quote: ... After incubation with HRP-conjugated secondary antibodies (1:5000, DAKO p0260 and p0217, 1h at RT), bands or dots were imaged on a chemiluminescence detection system (Bio-rad).
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR using Brilliant II SYBR® Green QPCR Master Mix (Agilent, Santa Clara, CA, USA) was outperformed on CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... the tissue sections were blocked for 1 h at RT with protein blocking solution (#X0909, Dako). After washing with PBS the aortic tissue sections were specifically stained with primary antibodies for platelet GPIbα (CD42b #M042-0 ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutants in the VPg cistron were synthesized by long inverse site-directed PCR mutagenesis using the QuickChange II XL Kit (Stratagene, San Diego CA, USA) following the manufacturer’s instructions and using p35STunos as template ...
-
bioRxiv - Physiology 2023Quote: ... Standard curves for each gene were generated by cloning qPCR products into the pSCA vector with the Strataclone PCR cloning kit (Agilent, Santa Clara, CA, USA), isolating plasmid DNA using the GeneJET Plasmid Miniprep Kit (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... A mutant Acr library was made using ACX175 as a backbone and error-prone PCR with low mutation rate using GeneMorph II random mutagenesis kit (Agilent, Santa Clara, CA, USA). The resulting library was subcloned into a second plasmid containing AiEvo2 ...
-
bioRxiv - Biochemistry 2023Quote: ... The cDNA of Affilin variant Af2p was used as template for error-prone PCR employing the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA, USA). The error rate was set to 10-14 mutations per kbp and the resulting theoretical library size was calculated to contain 6·1010 independent variants ...
-
bioRxiv - Biophysics 2019Quote: ... Mass spectrometry (performed on Agilent 7200B Quadrupole Time-of-Flight GC/MS) shifted unlabeled populations by 228 Da (SD = 2 Da ...
-
bioRxiv - Biochemistry 2022Quote: ... Time-curse reactions were directly monitored in a Stratagene Mx3005P (Agilent Technologies) using FAM filters ...
-
Macrodomain Mac1 of SARS-CoV-2 Nonstructural Protein 3 Hydrolyzes Diverse ADP-ribosylated SubstratesbioRxiv - Biochemistry 2023Quote: ... The reaction was stopped by 10% TFA and peptides were analyzed by Agilent 6530C Quadrupole-Time of Flight (QTOF) LC/MS (Agilent Technologies, DE, USA). Digested peptides were separated on ZORBAX 300SB-C18 MicroBore column (1.0 x 50 mm ...
-
bioRxiv - Microbiology 2023Quote: ... coupled to a quadrupole time-of-flight (QTOF) mass spectrometer (Agilent 6546), operating in negative mode ...
-
bioRxiv - Biochemistry 2020Quote: ... The immunohistochemical detection was performed using secondary antibody horseradish peroxidase labelled polymer and DAB reagent (Dako Cytomation).
-
bioRxiv - Biochemistry 2021Quote: ... Tandem MS/MS detection was performed with an Agilent 6410 Triple Quadrupole (Agilent Technologies, Santa Clara, CA) instrument with electron spray ionization in positive mode (ESI+) ...
-
bioRxiv - Microbiology 2021Quote: ... Detection of peroxidase activity in the F4 and CD3 slides was detected with AEC + substrate from Dako En Vision+ System-HRP and ImmPACT® AEC Substrate ...
-
bioRxiv - Microbiology 2022Quote: ... Antibody incubation and detection was performed on a Dako® OMNIS® automaton (Dako, Agilent Technologies, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... Data was assessed with a series of quality control metrics and analyzed using an aberration detection (ADM2) implemented in the CytoGenomics software versions 4.2 and 5.0.2.5 (Agilent Technologies). Aberrations were called using the ADM2 algorithm with a threshold setting of 6 and an aberration filter with a minimal number of probes = 3 and a minimal AvgAbsLogRatio = 0.25 ...
-
bioRxiv - Microbiology 2022Quote: ... Antibody incubation and detection was performed on a Dako® OMNIS® automaton (Dako, Agilent Technologies, USA).
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... Secondary antibody incubation was followed by colorimetric detection with diaminobenzidine (DAB) substrate-chromogen solution (Dako Omnis, Agilent) and counterstaining with methyl green solution.
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... Secondary antibody incubation was followed by colorimetric detection with diaminobenzidine (DAB) substrate-chromogen solution (Dako Omnis, Agilent) and counterstaining with methyl green solution.
-
bioRxiv - Genetics 2020Quote: ... Detection of analyzed phytohormones was performed using an Agilent 1260 Infinity series HPLC system (Agilent Technologies, USA) including a Q-ToF LC/MS mass spectrometer with Dual AJS ESI source ...
-
bioRxiv - Genetics 2020Quote: ... Mass spectrometric detection was performed on LC-ESI-MS system (Agilent Technologies 6460 Triple Quad LC/MS) equipped with an ESI ion source operated in the positive mode ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody detection was performed using EnVision FLEX/HRP (GV80011-2, Dako, Agilent Technologies, Santa Clara, CA, USA). IHC pictures were taken with a Pannoramic 250 Flash II Digital Slide Scanner and analyzed with the Pannoramic Viewer (3DHISTECH Ltd. ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance at 415 nm was measured with a Synergy 2 Multi-Detection Microplate Reader (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... For signal detection the samples were incubated with horseradish peroxidase-labelled streptavidin (Dako, Agilent Technologies, Glostrup, Denmark) for 20 minutes at room temperature followed by 3 × 5 minutes washing in PBS (pH 7.4 ...
-
bioRxiv - Microbiology 2023Quote: ... and detection window set to 100-1700 m/z with continuous infusion of a reference mass (Agilent ESI TOF Biopolymer Analysis Reference Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... DA content in lysates was measured using high-performance liquid chromatography (HPLC) equipped with fluorometric detection (Agilent) and a Zorbax Eclipse Plus C18 column (125 × 4.6 mm ...
-
bioRxiv - Pathology 2024Quote: ... Immunohistochemical analysis was conducted using a Dako EnVision+ Peroxidase Detection System (#K4003, Dako Cytomation, Carpinteria, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Peptide chromatographic separations and mass detection occurred with an Agilent 1260 nano/capillary HPLC system (Agilent Technologies) coupled to an Q-Exactive Orbitrap mass spectrometer (MS ...
-
bioRxiv - Biochemistry 2024Quote: ... Separation was confirmed by mass detection in collected fractions using a single quadrupole LC/MSD system (Agilent) and fractions containing Gal-GalNAc-Thr-AF488 (0.45 µmol ...
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... for 2 hours at RT before mounting the slices in a transparent mounting medium (DAKO, cat#S3023). We manually and blindly counted the number of WFA+ neurons within 0.5 × 0.5mm2 ROIs in three representative coronal sections covering OFC.
-
bioRxiv - Cell Biology 2023Quote: ... RT–qPCR reactions were performed using Brilliant III Ultra-Fast SYBR Green qPCR Master mix (Agilent Technologies) with the relevant primers (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed by using the Brilliant III SYBR® Green QPCR Master Mix (Agilent #600882) or DyNAmo HS SYBR Green (Thermo Scientific #F410L ...
-
bioRxiv - Cancer Biology 2024Quote: ... then long-term drug responses were recorded every 30 minutes through (RT-CES) (ACEA Biosciences; Agilent Technologies). Cell Index values (CI ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR amplification was performed by the use of an MX3000P Multiplex Quantitative PCR System (Stratagene, CA, USA). Data analysis was carried out with MxPRO qPCR software (Stratagene ...
-
bioRxiv - Genomics 2021Quote: ... the PCR was performed in triplicate per ligation reaction using the Herculase II PCR reagents (Agilent Technologies, 600677). The parallel library preparations and PCR reactions were subsequently pooled for each reaction.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).