Labshake search
Citations for Agilent :
851 - 900 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... coupled to a quadrupole time-of-flight (QTOF) mass spectrometer (Agilent 6546), operating in negative mode ...
-
bioRxiv - Biochemistry 2020Quote: ... The immunohistochemical detection was performed using secondary antibody horseradish peroxidase labelled polymer and DAB reagent (Dako Cytomation).
-
bioRxiv - Biochemistry 2021Quote: ... Tandem MS/MS detection was performed with an Agilent 6410 Triple Quadrupole (Agilent Technologies, Santa Clara, CA) instrument with electron spray ionization in positive mode (ESI+) ...
-
bioRxiv - Microbiology 2021Quote: ... Detection of peroxidase activity in the F4 and CD3 slides was detected with AEC + substrate from Dako En Vision+ System-HRP and ImmPACT® AEC Substrate ...
-
bioRxiv - Microbiology 2022Quote: ... Antibody incubation and detection was performed on a Dako® OMNIS® automaton (Dako, Agilent Technologies, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... Data was assessed with a series of quality control metrics and analyzed using an aberration detection (ADM2) implemented in the CytoGenomics software versions 4.2 and 5.0.2.5 (Agilent Technologies). Aberrations were called using the ADM2 algorithm with a threshold setting of 6 and an aberration filter with a minimal number of probes = 3 and a minimal AvgAbsLogRatio = 0.25 ...
-
bioRxiv - Microbiology 2022Quote: ... Antibody incubation and detection was performed on a Dako® OMNIS® automaton (Dako, Agilent Technologies, USA).
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... Secondary antibody incubation was followed by colorimetric detection with diaminobenzidine (DAB) substrate-chromogen solution (Dako Omnis, Agilent) and counterstaining with methyl green solution.
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... Secondary antibody incubation was followed by colorimetric detection with diaminobenzidine (DAB) substrate-chromogen solution (Dako Omnis, Agilent) and counterstaining with methyl green solution.
-
bioRxiv - Genetics 2020Quote: ... Detection of analyzed phytohormones was performed using an Agilent 1260 Infinity series HPLC system (Agilent Technologies, USA) including a Q-ToF LC/MS mass spectrometer with Dual AJS ESI source ...
-
bioRxiv - Genetics 2020Quote: ... Mass spectrometric detection was performed on LC-ESI-MS system (Agilent Technologies 6460 Triple Quad LC/MS) equipped with an ESI ion source operated in the positive mode ...
-
bioRxiv - Biochemistry 2024Quote: ... Separation was confirmed by mass detection in collected fractions using a single quadrupole LC/MSD system (Agilent) and fractions containing Gal-GalNAc-Thr-AF488 (0.45 µmol ...
-
bioRxiv - Pathology 2024Quote: ... Immunohistochemical analysis was conducted using a Dako EnVision+ Peroxidase Detection System (#K4003, Dako Cytomation, Carpinteria, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody detection was performed using EnVision FLEX/HRP (GV80011-2, Dako, Agilent Technologies, Santa Clara, CA, USA). IHC pictures were taken with a Pannoramic 250 Flash II Digital Slide Scanner and analyzed with the Pannoramic Viewer (3DHISTECH Ltd. ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance at 415 nm was measured with a Synergy 2 Multi-Detection Microplate Reader (Agilent Technologies).
-
bioRxiv - Molecular Biology 2023Quote: ... DA content in lysates was measured using high-performance liquid chromatography (HPLC) equipped with fluorometric detection (Agilent) and a Zorbax Eclipse Plus C18 column (125 × 4.6 mm ...
-
bioRxiv - Microbiology 2023Quote: ... and detection window set to 100-1700 m/z with continuous infusion of a reference mass (Agilent ESI TOF Biopolymer Analysis Reference Mix ...
-
bioRxiv - Microbiology 2023Quote: ... For signal detection the samples were incubated with horseradish peroxidase-labelled streptavidin (Dako, Agilent Technologies, Glostrup, Denmark) for 20 minutes at room temperature followed by 3 × 5 minutes washing in PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Peptide chromatographic separations and mass detection occurred with an Agilent 1260 nano/capillary HPLC system (Agilent Technologies) coupled to an Q-Exactive Orbitrap mass spectrometer (MS ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR amplification was performed by the use of an MX3000P Multiplex Quantitative PCR System (Stratagene, CA, USA). Data analysis was carried out with MxPRO qPCR software (Stratagene ...
-
bioRxiv - Genomics 2021Quote: ... the PCR was performed in triplicate per ligation reaction using the Herculase II PCR reagents (Agilent Technologies, 600677). The parallel library preparations and PCR reactions were subsequently pooled for each reaction.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Cancer Biology 2024Quote: ... then long-term drug responses were recorded every 30 minutes through (RT-CES) (ACEA Biosciences; Agilent Technologies). Cell Index values (CI ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed by using the Brilliant III SYBR® Green QPCR Master Mix (Agilent #600882) or DyNAmo HS SYBR Green (Thermo Scientific #F410L ...
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... for 2 hours at RT before mounting the slices in a transparent mounting medium (DAKO, cat#S3023). We manually and blindly counted the number of WFA+ neurons within 0.5 × 0.5mm2 ROIs in three representative coronal sections covering OFC.
-
bioRxiv - Cell Biology 2023Quote: ... RT–qPCR reactions were performed using Brilliant III Ultra-Fast SYBR Green qPCR Master mix (Agilent Technologies) with the relevant primers (Sigma-Aldrich) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... qRT-PCR was performed by MX3000P(Agilent) using UltraSYBR Mixture (Low ROX ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using AriaMX (Agilent) with 12.5 μl of either Power SYBR Green master mix or Taqman master mix (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... For PCR mutagenesis PFU Ultra Polymerase (Stratagene) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were confirmed by Tapestation (Agilent), and cleaned up with ExoSAP-IT (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... on AriaMx qRT-PCR system (Agilent Technologies). The following primers were used ...
-
bioRxiv - Cell Biology 2024Quote: ... and mycoplasma testing (MycoSensor PCR assay, Agilent) was performed yearly.
-
bioRxiv - Immunology 2020Quote: ... and Ii L17A was subsequently used as template for PCR quick change mutagenesis (all reagents used were included in the kit; QuickChange® Site-Directed Mutagenesis (Stratagene, La Jolla, CA, USA)) in order to generate the AP-3 binding motif RRP 21 ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplification was carried out using the Paq5000 Hotstart PCR Master Mix following the manufacturer’s protocol (Agilent, USA). Cycling was performed on an Applied Biosystems Thermal Cycler with cycles consisting of an initial denaturation step at 95°C for 2 min ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant (0.5 μL) was analyzed using gas chromatography with flame ionization detection (Agilent, Santa Clara, California, USA). The system was equipped with a DB FFAP analytical column (30m x 0.53 mm ID ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant (0.5 µL) was analyzed using gas chromatography with flame ionization detection (Agilent, Santa Clara, California, USA). The system was equipped with a DB FFAP analytical column (30m x 0.53 mm ID ...
-
bioRxiv - Cancer Biology 2020Quote: This was followed by a final wash and immunoperoxidase detection using a liquid DAB + substrate chromogen system (Dako). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... CH4 samples were analyzed immediately by flame ionization detection gas chromatography (Agilent 6890 N with Porapak Q column). The wetlands that were sampled in both experiments have no known prior history of agricultural use but are affected by runoff from surrounding agricultural and urban areas ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies and dilutions (dilution in DAKO REAL antibody diluent, S202230-2, DAKO, Carpinteria, CA, USA) used to study ALT were as follows ...
-
bioRxiv - Pathology 2021Quote: ... the slides were incubated with the appropriate horseradish peroxidase– conjugated secondary antibody (Dako, Via Real Carpintera, USA) for 30mn at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary and secondary antibodies were diluted in DAKO REAL antibody diluent (Agilent, UK, cat. no. S202230-2). Tissue sections were washed three times in PBS to remove excess antibodies after each antibody incubation step ...
-
bioRxiv - Genomics 2020Quote: ... Final library quality control consisted of confirmation of amplification and barcoding by SYBR Green-based RT-qPCR (Stratagene Mx3005P QPCR System ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The RT-qPCR was carried out using Brilliant III Ultra-fast SYBR green qPCR master mix (Agilent Technologies), on a AriaMx Real-time PCR system (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was undertaken following the Brilliant III Ultra Fast SYBR QPCR Master Mix protocol (Agilent Technologies, 600882) and results were analysed with MxPro v4.10 ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated for 1h at RT with the secondary antibody (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Dako; Polyclonal Goat Anti-Mouse Immunoglobulins/HRP ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were counterstained with DAPI for 1 min at RT and mounted with Fluorescence Mounting Medium (S3023; Dako). Fluorescence was observed with a SP8-DLS confocal microscope (Leica Microsystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted in PBS for 10 min at RT and accordingly mounted using DAKO fluorescent mounting medium (DAKO; S3023). Zeiss Axio Imager Z1 was used to image the samples ...