Labshake search
Citations for Agilent :
851 - 900 of 8233 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The quality of libraires was assessed by Agilent DNA 1000 kit (Agilent, Cat# 5067-1504)) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Genetics 2024Quote: ... Agilent SureSelect XT Library Prep Kit (Agilent) was used to repair DNA ends and for adaptor ligation following the standard protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... using SureSelect Target Enrichment kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... with the RNA 6000 Pico Kit (Agilent). RNA samples with RNA integrity number values greater than 9.0 were subjected to downstream analysis.
-
bioRxiv - Neuroscience 2024Quote: ... with the High Sensitivity DNA Kit (Agilent) according to manufacturer’s instructions and the 10X Genomics protocols ...
-
bioRxiv - Neuroscience 2024Quote: ... High pH kit reagents (K800021-5, Dako). pSer202/Thr205-tau antibody (MN1020B ...
-
bioRxiv - Microbiology 2024Quote: ... with the DNA High Sensitivity Kit (Agilent). The DNA concentration in the samples was quantified using the Qubit 2.0 instrument ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the kit High Sensitivity D5000 (Agilent) and the average size of the libraries was 284.25 ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP (1:200, rabbit, Dako; 1:1000, chicken, Millipore), MBP (1:500 ...
-
bioRxiv - Pathology 2020Quote: ... anti-HER2 (1:400 to 1:600, DAKO, Denmark), anti-PR antibody (DAKO ...
-
bioRxiv - Microbiology 2020Quote: ... The quantity and size distribution of the RNA and DNA were determined by Agilent Bioanalyzer 2100 with an RNA 6000 Pico Kit and a DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... Site-directed NS1 mutants were produced using a site-directed mutagenesis kit (QuikChange XL Site-Directed Mutagenesis Kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... a monoclonal mouse antibody against the intracellular tail of human HLA-DR α chain was used (Clone TAL.1B5, # M0746, Agilent, Santa Clara, CA, USA). Detection of MHC-I on the surface of cells was performed using a monoclonal mouse antibody against devil beta-2-microglobulin (B2M ...
-
bioRxiv - Genetics 2021Quote: ... and cultured chondrocytes of children (six girls and six boys) using catalog one-color microarrays (SurePrint G3 Human Gene Expression microarray, 8 × 60 k format; Agilent Technologies, Santa Clara, CA, USA). The data were analyzed using GeneSpring software (version 14.9 ...
-
bioRxiv - Pathology 2024Quote: Consecutive 4-μm slices of human-aspirated thrombi were immunohistochemically stained using antibodies against glycophorin A (erythrocyte marker, mouse monoclonal antibody, clone JC159; Dako/Agilent, Santa Clara, CA, USA), fibrin (mouse monoclonal antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... the expression of 2,459 mature miRNAs was investigated by the microRNA microarray analysis using SurePrint G3 8×60K Human miRNA Microarray chips (AMADID 70156; Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (NeuN, 1:20,000, Millipore, MAB377B; CD68, 1:1,000, Serotec, MCA1957S; GFAP, 1:10,000, Dako Z0334) were diluted in 0.3% Triton X in PBS and incubated for 12 hours at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD21 (DAKO, 1:25, CD23 (Leica, CD23-1B12, 1:50), CD4 (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Ki67 (1:50, clone MIB-1, Dako, M7240), mouse anti-INSR (1:50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 mouse (DAKO, clone MIB-1, 1:50); Anti-Ki-67 rabbit (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Biolegend, 829401, 1:1500 and Dako, Z0334, 1:1500), Nestin (Aveslabs ...
-
bioRxiv - Immunology 2023Quote: ... stained for H&E and HSV-1 (1:1000, Dako), and analyzed by a veterinary pathologist (Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... thyroid transcription factor (TTF-1) (mouse, M3575, 1:100; Dako), and p40 (rabbit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Genomics 2022Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using Illumina NovaSeq flowcell with 100 bp single-end runs.
-
bioRxiv - Neuroscience 2022Quote: ... cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen) and a qPCR add-on kit after which they were run on a Fragment Analyzer (Agilent), equimolar pooled and sequenced using an Illumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using Illumina NovaSeq flow cell with 100bp single-end runs.
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... RNA concentration and quality was measured using Agilent RNA 6000 Nano Kit and RNA 6000 Pico Kit (5067-1511 & 5067-1513, Agilent) on Agilent 2100 Bioanalyzer (Fig ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using the Illumina NovaSeq with 100 bp single-end runs.
-
bioRxiv - Molecular Biology 2023Quote: cDNA libraries were generated from RNA samples by using Kapa RNA HyperPrep Kit with RiboErase kit with quality assessed by Agilent High Sensitivity D1000 ScreenTape according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using NEBNext Library Quant Kit and libraries sizes were determined using Bioanalyzer High Sensitivity DNA Kit (Agilent). Indexed libraries were pooled and sequenced on an Illumina MiSeq using a MiSeq Reagent Kit v2 (150×150 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Amplified libraries were cleaned using 1x KAPA Pure Beads Libraries were quantified using NEBNext Library Quant Kit and libraries sizes were determined using Bioanalyzer High Sensitivity DNA Kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Final libraries were QCed using the Qubit dsDNA High Sensitivity kit and Bioanalyzer High Sensitivity DNA Kit (#5067-4627, Agilent). Libraries were sequenced at a concentration of 1.8 pM on a NextSeq with a 75 cycle v2 kit (#TG-160-2002 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library concentrations were measured by Qubit DNA HS kit and the fragment distribution was analyzed by the Bioanalyzer DNA HS kit (Agilent). Before sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... The RNA integrity number (RIN) was determined for each sample using Bioanalyzer RNA 6000 Nano Kit or Bioanalyzer RNA 6000 Pico Kit (Agilent) (RIN 8.83 ± 0.93 (mean ± s.d.)) ...
-
bioRxiv - Microbiology 2024Quote: DNA and RNA samples were analysed using either the Tapestation (Tapestation D1000 High Sensitivity DNA kit and Tapestation RNA ScreenTape kit, Agilent) or the Bioanalyzer (DNA 12000 kit ...
-
bioRxiv - Neuroscience 2024Quote: ... a G1603A CE-MS adaptor kit and a G1607A CE-electrospray ionization-mass spectrometry (ESI-MS) sprayer kit (Agilent Technologies). The system was controlled using G2201AA ChemStation software v.B.03.01 for CE (Agilent).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Seahorse mitotox assay was carried out according to Agilent seahorse XF mito tox assay kit user guide (kit 103595-100, Agilent). Briefly ...