Labshake search
Citations for Agilent :
801 - 850 of 2226 citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pVp16-Dest vector for IPTG (isopropyl-β-thiogalactopyranoside)-induced expression (3 h at 37°C) in E.coli strain ArcticExpress (Agilent). After sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then all membranes were washed 3 times and mounted on coverslips using an aqueous fluorescent mounting medium (DakoCytomation, Huddinge, Sweden). Samples were analysed with Leica TCS SP8 confocal microscope (Leica Microsystems ...
-
bioRxiv - Neuroscience 2021Quote: ... free floating sections were blocked with 3% donkey serum and incubated overnight with either rabbit anti-GFAP (1:10000, Dako), rat anti-CD68 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPEC-PTSCX sample cleanup pipette tips and Bond Elut C18/ 3 mL cleanup cartridges were from Agilent (Santa Clara, CA), cell culture slides (8-chamber ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 PCR reactions including two biological replicates and 3 technical replicates per gene were performed using Brilliant SYBR master mix (Agilent), running cycles of 10 minutes at 95°C ...
-
bioRxiv - Molecular Biology 2021Quote: Primary brown adipose cells were isolated and cultured for 3 days before plated in XF cell culture microplates (Seahorse Bioscience). Cells (10,000 cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glacial acetic acid was added to dissolve the crystals and the absorbance was measured at 595 nm with a Cytation 3 Image Reader (Agilent). The values of vehicle-treated controls were set to 100%.
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Microbiology 2024Quote: ... These pellets were lysed and 3 µl samples were analyzed using Agilent InfinityLab Poroshell 120 HILIC-Z (Agilent 683775-924). The chromatographic separation employed two solvent phases ...
-
bioRxiv - Synthetic Biology 2024Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2024Quote: The separation was performed using a ZORBAX RRHD Eclipse Plus (C18, 3 × 50 mm, 1.8 μm; Agilent Agilent 959757-302) or a Poroshell 120 EC-C18 ...
-
bioRxiv - Microbiology 2024Quote: The separation was performed using a ZORBAX RRHD Eclipse Plus (C18, 3 × 50 mm, 1.8 μm; Agilent Agilent 959757-302) or a Poroshell 120 EC-C18 ...
-
bioRxiv - Immunology 2024Quote: ... cDNA and libraries were made using the Lexogen QuantSeq 3’ mRNA-seq FWD library prep kit and quality was assessed by Agilent High Sensitivity DNA kit on a Bioanalyzer (Agilent) ...
-
bioRxiv - Biochemistry 2024Quote: ... The effect of PFKFB2/3 inhibitors on glycolysis was determined by glycolysis stress test utilizing Seahorse XFe24 Extracellular Flux Analyzer (Agilent) measuring extracellular acidification rate (ECAR ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2024Quote: ... sections were washed in PBS three times for 3 minutes each before being incubated with DAKO Rabbit/Mouse HRP Kit-provided HRP (Mouse-K4001, Rabbit-K4003; Dako) for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated for 45 minutes at room temperature with the anti-SARS spike glycoprotein antibody 3A2 (rabbit, Abcam ab272420 1:100 diluted in Dako REAL antibody diluent #S2022), which has been validated in previous publications20,41 ...